KIAA0392

Product ID	ORK04897
Accession No	AB002390
Description	ectonucleoside triphosphate diphosphohydrolase 4
Clone name	hh00034
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5422 bp) Predicted protein sequence (550 aa)
Source	Human adult brain
Rouge ID	mKIAA0392 by Kazusa Mouse cDNA Project

Length: 5422 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3769 bp
Genome contig ID	gi51511724r_23242621
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ACTGAAAAATCAATAAAACGAAAGTTCATCATCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGCCCGTAGACTGTGTGGGCTTGCTTCCTTGTCATCTTTGAATCTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	23342621	23362231	11	99.2	Perfect prediction

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW63621	100.0	ectonucleoside ...	Homo sapiens
AAC17217	100.0	guanosine-dipho...	Homo sapiens
XP_519659	99.8	ectonucleoside ...	Pan troglodytes
Q9Y227	98.6	Ectonucleoside ...	Homo sapiens
XP_001108472	98.5	ectonucleoside ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000407	22	483	PF01150	Nucleoside phosphatase GDA1/CD39
ScanRegExp	IPR000407	159	174	PS01238	Nucleoside phosphatase GDA1/CD39

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	497	NHYLFSGCFLVVLLAILLYLLR	518	PRIMARY	22

Primer_f	GACCTTCCGAGAGTATTATTC
Primer_r	TGAATGATGTGACCAACCAAG
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GACCTTCCGAGAGTATTATTC
Primer_r	TGAATGATGTGACCAACCAAG
PCR product length	153 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles