KIAA0350

Gene/Protein Characteristic Table for KIAA0350

Order Kazusa clone(s) from :

Product ID	ORK01071
Accession No	AB002348
Description	C-type lectin domain family 16, member A, transcript variant 1
Clone name	hg01945
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6786 bp) Predicted protein sequence (1062 aa)
HaloTag ORF Clone	FHC01071
Flexi ORF Clone	FXC01071
Source	Human adult brain
Rouge ID	mKIAA0350 by Kazusa Mouse cDNA Project
Note	We replaced hg01581, former representative clones for KIAA0350 with hg01945. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 6786 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3491 bp
Genome contig ID	gi51511732f_10845943
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAATTTAAACTTGGCAATAAAAGAGAAAAAAAGTT
Flanking genome sequence (337598 - 337647)	----+--------+--------+--------+--------+----* ACCAAGAATGTAGCGTGCTGCTCCTGGGGGCTGTGGCAGGAGGCCGTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	10945943	11183539	23	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 1062 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001104364	0	97.3	similar to CG12...	Macaca mulatta
XP_871847	0	93.1	similar to Prot...	Bos taurus
BAE42005	0	94.5	unnamed protein...	Mus musculus
BAE33184	0	94.1	unnamed protein...	Mus musculus
CAG02693	1e-209	65.4	unnamed protein...	Tetraodon nigro...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001304	575	597	PS00615	C-type lectin

Expression profile

Description

RT-PCR

RT-PCR-ELISA

Experimental conditions

Primer_f	TTCCAGTTTTCATTTCCACCC
Primer_r	TTGTCCCAGTGAGAACCGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TTCCAGTTTTCATTTCCACCC
Primer_r	TTGTCCCAGTGAGAACCGAGG
PCR product length	137 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp