Order Kazusa clone(s) from : ![]() |
Product ID | ORK00500 |
---|---|
Accession No | AB002311 |
Description | Rap guanine nucleotide exchange factor (GEF) 2 |
Clone name | hg00186 |
Vector information | |
cDNA sequence | DNA sequence (6568 bp) Predicted protein sequence (1508 aa) |
HaloTag ORF Clone |
FHC00500
![]() |
Flexi ORF Clone | FXC00500 |
Source | Human adult brain |
Rouge ID |
mKIAA0313
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000595 | 163 | 249 | PF00027 | Cyclic nucleotide-binding |
IPR000651 | 279 | 366 | PF00618 | Guanine nucleotide exchange factor for Ras-like GTPases | |
IPR001478 | 419 | 473 | PF00595 | PDZ/DHR/GLGF | |
IPR000159 | 615 | 701 | PF00788 | Ras-association | |
IPR001895 | 723 | 908 | PF00617 | Guanine-nucleotide dissociation stimulator CDC25 | |
HMMSmart | IPR000595 | 144 | 262 | SM00100 | Cyclic nucleotide-binding |
IPR000651 | 276 | 389 | SM00229 | Guanine nucleotide exchange factor for Ras-like GTPases | |
IPR001478 | 404 | 476 | SM00228 | PDZ/DHR/GLGF | |
IPR000159 | 615 | 701 | SM00314 | Ras-association | |
IPR001895 | 722 | 959 | SM00147 | Guanine-nucleotide dissociation stimulator CDC25 | |
ProfileScan | IPR000595 | 144 | 244 | PS50042 | Cyclic nucleotide-binding |
IPR000651 | 276 | 389 | PS50212 | Guanine nucleotide exchange factor for Ras-like GTPases | |
IPR001478 | 394 | 464 | PS50106 | PDZ/DHR/GLGF | |
IPR000159 | 615 | 701 | PS50200 | Ras-association | |
IPR001895 | 726 | 953 | PS50009 | Guanine-nucleotide dissociation stimulator CDC25 |
![]() |
---|
Primer_f | TGCACTTGACATCACAGAGCG |
---|---|
Primer_r | GAAATCTAGCTCTACCACAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCACTTGACATCACAGAGCG |
Primer_r | GAAATCTAGCTCTACCACAAG |
PCR product length | 102 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |