Order Kazusa clone(s) from : ![]() |
Product ID | ORK00495 |
---|---|
Accession No | AB006624 |
Description | nuclear envelope integral membrane protein 1, transcript variant 1 |
Clone name | ha06800s1 |
Vector information | |
cDNA sequence | DNA sequence (5577 bp) Predicted protein sequence (446 aa) |
HaloTag ORF Clone |
FHC00495
![]() |
Flexi ORF Clone | FXC00495 |
Source | Human adult brain |
Rouge ID |
mKIAA0286
by Kazusa Mouse cDNA Project
|
Note | We replaced ha06800, former representative clones for KIAA0286 with ha06800s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4235 bp |
---|---|
Genome contig ID | gi89161190r_55635694 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 55735694 | 55758802 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | ATMAGGMKVAVSPAVGPGPWGSG | 23 | SECONDARY | 23 | 2 | 28 | GTVRLLLILSGCLVYGTAETDVN | 50 | SECONDARY | 23 | 3 | 161 | FDPKLFLVFLLGLMLFFCGDLLS | 183 | PRIMARY | 23 | 4 | 192 | TGMTVGIVASLLIIIFILSKFMP | 214 | PRIMARY | 23 | 5 | 220 | YVILVGGWSFSLYLIQLVFKNLQ | 242 | PRIMARY | 23 | 6 | 250 | QYLLSYVLTVGFMSFAVCYKYG | 271 | PRIMARY | 22 | 7 | 287 | QLMGLCFMYSGIQIPHIALAIII | 309 | PRIMARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | test |
Panel name | Genebridge 4 |
---|---|
Primer_f | GATGTTGGTGCCTTATGTGAC |
Primer_r | ACTCCCATCTGCCACTAAAGC |
PCR product length | 99 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |