KIAA0243

Gene/Protein Characteristic Table for KIAA0243

Order Kazusa clone(s) from :

Product ID	ORK07224
Accession No	D87683
Description	tuberous sclerosis 1
Clone name	ha04782
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6984 bp) Predicted protein sequence (699 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0243 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 6984 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4884 bp
Genome contig ID	gi89161216r_134656558
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AACTGTGAACAAATAAAAATTTATTGTTTTGCACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTGCTGTGTGGACATGGAGTGGCTTACACTGGCCTTGGCAGGCTTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	134756558	134771981	10	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH13883	0	100.0	unnamed protein...	Homo sapiens
Q92574	0	100.0	Hamartin; Tuber...	Homo sapiens
XP_520334	0	99.9	tuberous sclero...	Pan troglodytes
CAH89743	0	98.7	hypothetical pr...	Pongo abelii
XP_001168941	3.7e-216	99.9	tuberous sclero...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007483	1	254	PF04388	Hamartin

Expression profile

Description

Northern blot

Experimental conditions

Primer_f
Primer_r
PCR conditions	test

RH mapping information

Description

Chromosome No. 9

Experimental conditions

Panel name	Genebridge 4
Primer_f	TAAACTTTCCCGCCTCAATCC
Primer_r	CCCATTCACTAAGATTGTACC
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp