Order Kazusa clone(s) from : ![]() |
Product ID | ORK00028 |
---|---|
Accession No | D63478 |
Description | ubiquitin associated protein 2-like, transcript variant 2 |
Clone name | ha03843 |
Vector information | |
cDNA sequence | DNA sequence (3411 bp) Predicted protein sequence (983 aa) |
HaloTag ORF Clone |
FHC00028
![]() |
Flexi ORF Clone | FXC00028 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0144
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 353 bp |
---|---|
Genome contig ID | gi89161185f_152359279 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (143328 - 143377) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 152459279 | 152502605 | 25 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000449 | 49 | 89 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
HMMSmart | IPR000449 | 50 | 88 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
ProfileScan | IPR000449 | 49 | 89 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
Panel name | Genebridge 4 |
---|---|
Primer_f | ACTTAAACTCCCACCTACTCC |
Primer_r | TGAGGTTGTTCCCAGTTTCCC |
PCR product length | 147 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |