KIAA0143

Product ID	ORK00027
Accession No	D63477
Description	EFR3 homolog A
Clone name	ha03871
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5286 bp) Predicted protein sequence (885 aa)
HaloTag ORF Clone	FHC00027
Flexi ORF Clone	FXC00027
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0143 by Kazusa Mouse cDNA Project

Length: 5286 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2627 bp
Genome contig ID	gi51511724f_132885549
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTATTAAATGCAATAAAGTTAGTTTTTGAAATGT
Flanking genome sequence (209404 - 209453)	----+--------+--------+--------+--------+----* AAAAATTCACTGTGCAATTCATATGTCAGCAATAAAACATAGATTATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	132985549	133094951	23	99.4	Perfect prediction

Length: 885 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH71611	99.8	EFR3A protein [...	Homo sapiens
Q14156	100.0	Protein EFR3 ho...	Homo sapiens
XP_001499008	98.5	similar to Prot...	Equus caballus
EDM16167	97.6	similar to RIKE...	Rattus norvegicus
Q8BG67	97.1	Protein EFR3 ho...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023170	1.2e-157	60.0	KIAA0953

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GGAAACGATAATAGGACAAGC
Primer_r	TCAAGAGGCAAAGTTCCAGTG
PCR product length	230 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles