Order Kazusa clone(s) from : ![]() |
Product ID | ORK00409 |
---|---|
Accession No | D14658 |
Description | signal peptidase complex subunit 2 |
Clone name | ha00791 |
Vector information | |
cDNA sequence | DNA sequence (1370 bp) Predicted protein sequence (225 aa) |
HaloTag ORF Clone |
FHC00409
![]() |
Flexi ORF Clone | FXC00409 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0102
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 691 bp |
---|---|
Genome contig ID | gi51511727f_74237981 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (128448 - 128497) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 74337981 | 74366427 | 5 | 100.0 | Perfect prediction |
| 1 | r | 28294148 | 28295518 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR009582 | 42 | 223 | PF06703 | Microsomal signal peptidase 25 kDa subunit |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 82 | GRLTICTISCFFAIVALIWDYMH | 104 | PRIMARY | 23 | 2 | 112 | VLALCVISYFVMMGILTIYTSY | 133 | SECONDARY | 22 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | AGTGGGAGAACAAAGCAGCAG |
Primer_r | TTTTTATCTCCCCCACCCCCC |
PCR product length | 223 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |