Order Kazusa clone(s) from : ![]() |
Product ID | ORK06520 |
---|---|
Accession No | D38521 |
Description | proteasome (prosome, macropain) activator subunit 4 |
Clone name | ha00919 |
Vector information | |
cDNA sequence | DNA sequence (6106 bp) Predicted protein sequence (1798 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0077
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 708 bp |
---|---|
Genome contig ID | gi89161199r_53845511 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 53945511 | 54051291 | 47 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GGCTGCTGGATTTAGGTGGTA |
Primer_r | CATCAGGTCATTGGTTAGGTT |
PCR product length | 129 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |