Order Kazusa clone(s) from : ![]() |
Product ID | ORK01031 |
---|---|
Accession No | AK024449 |
Clone name | as00041 |
Vector information | |
cDNA sequence | DNA sequence (4689 bp) Predicted protein sequence (330 aa) |
HaloTag ORF Clone |
FHC01031
![]() |
Flexi ORF Clone | FXC01031 |
Source | Human spleen |
Rouge ID |
mFLJ00041
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR003599 | 58 | 188 | SM00409 | Immunoglobulin subtype |
ProfileScan | IPR007110 | 48 | 211 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 34 | GSLLFALFLAASLGPVAAFKVAT | 56 | PRIMARY | 23 | 2 | 212 | AAALATGACIVGILCLPLILLLV | 234 | PRIMARY | 23 |
---|
![]() |
Primer_f | GGAATTAGGGGCCATCTTACC |
---|---|
Primer_r | CTCCATGGTGTGTTTTTAGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |