Gene/Protein Characteristic Table for FLJ00401

Description

Product ID:	ORK05283
Accession No.:	AK090479
Alias Name:
Clone Name:	sj07492 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4699
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi29824572r_88965019
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATATTACAGACTGACCAGGCTCTCACAGAGACGG
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 504

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC03460	1.9e-205	100.0	FLJ00401 protei...	Homo sapiens
AAO40731	2.5e-196	100.0	CTCL tumor anti...	Homo sapiens
AAQ89312	2.9e-196	100.0	ALEI2427 [Homo ...	Homo sapiens
Q96PP8	2.9e-196	100.0	Guanylate-bindi...	Homo sapiens
AAX29910	2.9e-196	100.0	guanylate bindi...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AK131094	7.4e-102	57.1	FLJ00316

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003191 39 301 PF02263 Guanylate-binding protein

IPR003191 303 504 PF02841 Guanylate-binding protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003191	39	301	PF02263	Guanylate-binding protein
IPR003191	303	504	PF02841	Guanylate-binding protein

Method	From	To	amino acid sequence
-	-	-	-

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	0 bp
Genome contig ID	gi29824572r_88965019
PolyA signal sequence (None)	+--------+--------+----*----+---- AATATTACAGACTGACCAGGCTCTCACAGAGACGG
Flanking genome sequence	None