Gene/Protein Characteristic Table for FLJ00229 |
Description |
Product ID: | ORK01654 |
---|---|
Accession No.: | AK074156 |
Alias Name: | |
Clone Name: | sj06546 [Vector Info] |
Source: | Human spleen |
Features of the cloned DNA sequence | Description |
---|
Length: 4641
cloned DNA seq.
| |
Length of 3'UTR 2756 bp Genome contig ID gi29824574r_57366037 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
CCAAAAACTAAATTAAAGGCCTTGGATTTTAAAGCFlanking genome sequence None
Features of the predicted protein sequence | Description |
---|
Length: 627
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |