Gene/Protein Characteristic Table for FLJ00229

Description

Product ID:	ORK01654
Accession No.:	AK074156
Alias Name:
Clone Name:	sj06546 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4641
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2756 bp

Genome contig ID gi29824574r_57366037
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
CCAAAAACTAAATTAAAGGCCTTGGATTTTAAAGC
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 627

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB84982	100.0	FLJ00229 protei...	Homo sapiens
XP_516553	99.5	similar to FLJ0...	Pan troglodytes
XP_001096032	97.9	similar to F53H...	Macaca mulatta
BAG11118	100.0	FAM116A protein...	synthetic construct
Q8IWF6	99.8	Protein FAM116A.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2756 bp
Genome contig ID	gi29824574r_57366037
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- CCAAAAACTAAATTAAAGGCCTTGGATTTTAAAGC
Flanking genome sequence	None