Gene/Protein Characteristic Table for FLJ00190

Description

Product ID:	ORK05512
Accession No.:	AK160364
Alias Name:
Clone Name:	sj02368 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4519
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2953 bp

Genome contig ID gi29824572r_23439775
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CTAAACTGTTTAAATAAAGAGCTCTATTTTTAAAG
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 521

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD18707	9.6e-208	100.0	FLJ00190 protei...	Homo sapiens
Q8IU57	1.9e-207	100.0	Interleukin-28 ...	Homo sapiens
XP_001105189	3.2e-178	86.5	similar to inte...	Macaca mulatta
EAW95113	1.6e-172	100.0	interleukin 28 ...	Homo sapiens
XP_874034	2.5e-131	67.0	similar to inte...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000282 28 124 PS50299 Cytokine receptor class 2

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000282	28	124	PS50299	Cytokine receptor class 2

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 223 245 VPEANWAFLVLPSLLILLLVIAA

Method	From	To	amino acid sequence
SOSUI	223	245	VPEANWAFLVLPSLLILLLVIAA

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2953 bp
Genome contig ID	gi29824572r_23439775
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTAAACTGTTTAAATAAAGAGCTCTATTTTTAAAG
Flanking genome sequence	None