Gene/Protein Characteristic Table for FLJ00168

Description

Product ID:	ORK01037
Accession No.:	AK074097
Alias Name:
Clone Name:	sh07625 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 5658
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3891 bp

Genome contig ID gi29824590r_54956218
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGCTGCCATGTTGTTAACGAGCACCGATTTCCTCT
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 588

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB84923	100.0	FLJ00168 protei...	Homo sapiens
Q96RQ9	100.0	L-amino-acid ox...	Homo sapiens
AAZ32711	97.3	interleukin-4 i...	Homo sapiens
AAH64378	99.8	Interleukin 4 i...	Homo sapiens
AAI31626	97.1	Interleukin 4 i...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011173	2.9e-06	24.9	KIAA0601

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002937 90 526 PF01593 Amine oxidase

ProfileScan IPR000205 83 113 PS50205 NAD-binding site

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002937	90	526	PF01593	Amine oxidase
ProfileScan	IPR000205	83	113	PS50205	NAD-binding site

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 20 42 RVMAPLALHLLVLVPILLSLVAS

Method	From	To	amino acid sequence
SOSUI	20	42	RVMAPLALHLLVLVPILLSLVAS

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3891 bp
Genome contig ID	gi29824590r_54956218
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCTGCCATGTTGTTAACGAGCACCGATTTCCTCT
Flanking genome sequence	None