Gene/Protein Characteristic Table for FLJ00168 |
Description |
Product ID: | ORK01037 |
---|---|
Accession No.: | AK074097 |
Alias Name: | |
Clone Name: | sh07625 [Vector Info] |
Source: | Human spleen |
Features of the cloned DNA sequence | Description |
---|
Length: 5658
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | |
Warning for coding interruption: |
Length of 3'UTR 3891 bp Genome contig ID gi29824590r_54956218 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGCTGCCATGTTGTTAACGAGCACCGATTTCCTCTFlanking genome sequence None
Features of the predicted protein sequence | Description |
---|
Length: 588
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002937 | 90 | 526 | PF01593 | Amine oxidase |
ProfileScan | IPR000205 | 83 | 113 | PS50205 | NAD-binding site |
Method | From | To | amino acid sequence |
---|---|---|---|
SOSUI | 20 | 42 | RVMAPLALHLLVLVPILLSLVAS |