Miyakogusa Predicted Gene

Lj6g3v2274730.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v2274730.1 Non Chatacterized Hit- tr|G7LER4|G7LER4_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,36.13,1e-18,
,gene.g67743.t1.1
         (1038 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-lik...    84   2e-15
gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-li...    80   3e-14
gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosom...    66   5e-10
gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-li...    64   2e-09
gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyc...    58   1e-07
gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-li...    56   5e-07
gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyc...    56   5e-07
gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cy...    52   7e-06

>gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (6%)
          Length = 881

 Score = 83.8 bits (42), Expect = 2e-15
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                     
Query: 648 tgggagcaatctttcttccattgaacaagtgaatattaatgcagcaatttggtctgtt 705
           ||||||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||
Sbjct: 138 tgggagcaatctttcttcccttgaacaagtgaatattgatgcagaaattcggtctgtt 195



 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                        
Query: 964  atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatc 1023
            |||||||||||| |||| |||||||| |||| ||| || || ||||| ||||||||||||
Sbjct: 520  atacctgatggagtagtggactttttacttcaaaactcgccgtccgctaaggttgacatc 579

               
Query: 1024 ata 1026
            |||
Sbjct: 580  ata 582



 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 769 agctggctgctaaaactttccaatataaaatcgttgacaatcactacaagtactcttcag 828
           ||||||||| || | ||| ||||||||||||| |||||| |  || |||| |||||||||
Sbjct: 259 agctggctggtagagcttaccaatataaaatcattgacagtatctgcaagaactcttcag 318

                 
Query: 829 gttctc 834
           ||||||
Sbjct: 319 gttctc 324


>gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (14%)
          Length = 508

 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 115/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttcaccaaatttttgtctaggcttttgactcttcgtgatggttcggccgcgctgcacgag 147
           |||||||||||  ||||| |||||||||||||||| ||||| ||| ||||||||||||  
Sbjct: 332 ttcaccaaattcgtgtctcggcttttgactcttcgcgatggctcgaccgcgctgcacggt 391

                                                                       
Query: 148 ctccgtttctggcgcggtcgtcccatccagactcaactcctcaaaaggatggtaaaatat 207
           ||   |||   ||  | | ||| ||| ||| |||| |||||||||||||| |||||||||
Sbjct: 392 ctagattttgagcatgatggtcacattcagcctcacctcctcaaaaggattgtaaaatat 451

                               
Query: 208 gttgtttcacacaatatcca 227
           | ||||||||||||| ||||
Sbjct: 452 gctgtttcacacaatgtcca 471


>gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosome undetermined
           scaffold_6, whole genome shotgun sequence; n=1;
           Paramecium tetraurelia|Rep: Chromosome undetermined
           scaffold_6, whole genome shotgun sequence - Paramecium
           tetraurelia, partial (3%)
          Length = 740

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 648 tgggagcaatctttcttccattgaacaagtgaatatt 684
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 700 tgggagcaatctttcttcccttgaacaagtgaatatt 736


>gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
            truncatula|Rep: Cyclin-like F-box - Medicago truncatula
            (Barrel medic), partial (6%)
          Length = 654

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 967  cctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatcata 1026
            |||||||||||||| ||||||||| ||| |||||||||||| ||| | ||||| ||||||
Sbjct: 235  cctgatggaatagtggactttttgattcaaaattcaccatcagcagaagttgaaatcata 176


>gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
            Medicago truncatula|Rep: Cyclin-like F-box - Medicago
            truncatula (Barrel medic), partial (37%)
          Length = 1467

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 104/129 (80%)
 Strand = Plus / Plus

                                                                        
Query: 769  agctggctgctaaaactttccaatataaaatcgttgacaatcactacaagtactcttcag 828
            ||||||||| || | ||| ||||||||||||| |||||  |  | |||||||||||||||
Sbjct: 1038 agctggctggtagaccttaccaatataaaatcattgacggtttccacaagtactcttcag 1097

                                                                        
Query: 829  gttctcagcttatttcctcttttatcggaggttaagcctcctatcttgaataccttggag 888
            ||||||| || | |||||| ||| |  |||  ||||  ||||||||||  || |||| ||
Sbjct: 1098 gttctcatctcaattcctcatttgttagagtataagtatcctatcttgggtagcttgaag 1157

                     
Query: 889  tcattgaaa 897
            |||||||||
Sbjct: 1158 tcattgaaa 1166



 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                        
Query: 962  ctatacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgaca 1021
            ||||||| ||||||| ||| |||| |||||||| ||| ||||| || || ||||||||||
Sbjct: 1201 ctataccggatggaacagtggactatttgcttcaaaactcaccctctgccaaggttgaca 1260

                 
Query: 1022 tcata 1026
            |||||
Sbjct: 1261 tcata 1265


>gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
            truncatula|Rep: Cyclin-like F-box - Medicago truncatula
            (Barrel medic), partial (5%)
          Length = 536

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 964  atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1019
            ||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 469  atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 414


>gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
            Medicago truncatula|Rep: Cyclin-like F-box - Medicago
            truncatula (Barrel medic), partial (14%)
          Length = 718

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 964  atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1019
            ||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 343  atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 398


>gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (14%)
          Length = 555

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 5   tatccacaagatggaagaatctttggaaac 34
           |||||||||||||||||||||| |||||||
Sbjct: 274 tatccacaagatggaagaatctctggaaac 303