Miyakogusa Predicted Gene
- Lj6g3v2274730.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v2274730.1 Non Chatacterized Hit- tr|G7LER4|G7LER4_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,36.13,1e-18,
,gene.g67743.t1.1
(1038 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-lik... 84 2e-15
gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-li... 80 3e-14
gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosom... 66 5e-10
gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-li... 64 2e-09
gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyc... 58 1e-07
gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-li... 56 5e-07
gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyc... 56 5e-07
gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cy... 52 7e-06
>gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (6%)
Length = 881
Score = 83.8 bits (42), Expect = 2e-15
Identities = 54/58 (93%)
Strand = Plus / Plus
Query: 648 tgggagcaatctttcttccattgaacaagtgaatattaatgcagcaatttggtctgtt 705
||||||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||
Sbjct: 138 tgggagcaatctttcttcccttgaacaagtgaatattgatgcagaaattcggtctgtt 195
Score = 61.9 bits (31), Expect = 7e-09
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 964 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatc 1023
|||||||||||| |||| |||||||| |||| ||| || || ||||| ||||||||||||
Sbjct: 520 atacctgatggagtagtggactttttacttcaaaactcgccgtccgctaaggttgacatc 579
Query: 1024 ata 1026
|||
Sbjct: 580 ata 582
Score = 52.0 bits (26), Expect = 7e-06
Identities = 56/66 (84%)
Strand = Plus / Plus
Query: 769 agctggctgctaaaactttccaatataaaatcgttgacaatcactacaagtactcttcag 828
||||||||| || | ||| ||||||||||||| |||||| | || |||| |||||||||
Sbjct: 259 agctggctggtagagcttaccaatataaaatcattgacagtatctgcaagaactcttcag 318
Query: 829 gttctc 834
||||||
Sbjct: 319 gttctc 324
>gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (14%)
Length = 508
Score = 79.8 bits (40), Expect = 3e-14
Identities = 115/140 (82%)
Strand = Plus / Plus
Query: 88 ttcaccaaatttttgtctaggcttttgactcttcgtgatggttcggccgcgctgcacgag 147
||||||||||| ||||| |||||||||||||||| ||||| ||| ||||||||||||
Sbjct: 332 ttcaccaaattcgtgtctcggcttttgactcttcgcgatggctcgaccgcgctgcacggt 391
Query: 148 ctccgtttctggcgcggtcgtcccatccagactcaactcctcaaaaggatggtaaaatat 207
|| ||| || | | ||| ||| ||| |||| |||||||||||||| |||||||||
Sbjct: 392 ctagattttgagcatgatggtcacattcagcctcacctcctcaaaaggattgtaaaatat 451
Query: 208 gttgtttcacacaatatcca 227
| ||||||||||||| ||||
Sbjct: 452 gctgtttcacacaatgtcca 471
>gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosome undetermined
scaffold_6, whole genome shotgun sequence; n=1;
Paramecium tetraurelia|Rep: Chromosome undetermined
scaffold_6, whole genome shotgun sequence - Paramecium
tetraurelia, partial (3%)
Length = 740
Score = 65.9 bits (33), Expect = 5e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 648 tgggagcaatctttcttccattgaacaagtgaatatt 684
||||||||||||||||||| |||||||||||||||||
Sbjct: 700 tgggagcaatctttcttcccttgaacaagtgaatatt 736
>gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
truncatula|Rep: Cyclin-like F-box - Medicago truncatula
(Barrel medic), partial (6%)
Length = 654
Score = 63.9 bits (32), Expect = 2e-09
Identities = 53/60 (88%)
Strand = Plus / Minus
Query: 967 cctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatcata 1026
|||||||||||||| ||||||||| ||| |||||||||||| ||| | ||||| ||||||
Sbjct: 235 cctgatggaatagtggactttttgattcaaaattcaccatcagcagaagttgaaatcata 176
>gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (37%)
Length = 1467
Score = 58.0 bits (29), Expect = 1e-07
Identities = 104/129 (80%)
Strand = Plus / Plus
Query: 769 agctggctgctaaaactttccaatataaaatcgttgacaatcactacaagtactcttcag 828
||||||||| || | ||| ||||||||||||| ||||| | | |||||||||||||||
Sbjct: 1038 agctggctggtagaccttaccaatataaaatcattgacggtttccacaagtactcttcag 1097
Query: 829 gttctcagcttatttcctcttttatcggaggttaagcctcctatcttgaataccttggag 888
||||||| || | |||||| ||| | ||| |||| |||||||||| || |||| ||
Sbjct: 1098 gttctcatctcaattcctcatttgttagagtataagtatcctatcttgggtagcttgaag 1157
Query: 889 tcattgaaa 897
|||||||||
Sbjct: 1158 tcattgaaa 1166
Score = 58.0 bits (29), Expect = 1e-07
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 962 ctatacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgaca 1021
||||||| ||||||| ||| |||| |||||||| ||| ||||| || || ||||||||||
Sbjct: 1201 ctataccggatggaacagtggactatttgcttcaaaactcaccctctgccaaggttgaca 1260
Query: 1022 tcata 1026
|||||
Sbjct: 1261 tcata 1265
>gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
truncatula|Rep: Cyclin-like F-box - Medicago truncatula
(Barrel medic), partial (5%)
Length = 536
Score = 56.0 bits (28), Expect = 5e-07
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 964 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1019
||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 469 atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 414
>gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (14%)
Length = 718
Score = 56.0 bits (28), Expect = 5e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 964 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1019
||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 343 atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 398
>gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (14%)
Length = 555
Score = 52.0 bits (26), Expect = 7e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 5 tatccacaagatggaagaatctttggaaac 34
|||||||||||||||||||||| |||||||
Sbjct: 274 tatccacaagatggaagaatctctggaaac 303