Miyakogusa Predicted Gene
- Lj5g3v1530050.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v1530050.1 CUFF.55411.1
(390 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75258 similar to UniRef100_Q9XHL6 Cluster: Sucrose tr... 82 3e-15
>gnl|LJGI|TC75258 similar to UniRef100_Q9XHL6 Cluster: Sucrose transport protein
SUT1; n=1; Pisum sativum|Rep: Sucrose transport protein
SUT1 - Pisum sativum (Garden pea), partial (27%)
Length = 487
Score = 81.8 bits (41), Expect = 3e-15
Identities = 86/101 (85%)
Strand = Plus / Plus
Query: 137 tgcggcccaatctccggcattctagtccagcacatcgttggctacctcagcgactgttgc 196
|||||||||||||| ||||| || ||||||| |||||| || |||| ||||||| | |||
Sbjct: 247 tgcggcccaatctctggcatgctggtccagcccatcgtcggttaccacagcgaccgctgc 306
Query: 197 acatcccgcttcggctgccgccgccctttcatcaccgccgg 237
|| || ||||||||| ||||||| || |||||| |||||||
Sbjct: 307 acttcacgcttcggccgccgccgtcccttcatcgccgccgg 347
Score = 63.9 bits (32), Expect = 7e-10
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 318 cccgcgccatcgccgtcttcgtcgtcgaattctggatcttcgacgtcg 365
|||||||||||||| ||||| |||||| |||||||||| |||||||||
Sbjct: 440 cccgcgccatcgccatcttcatcgtcggattctggatcctcgacgtcg 487