Miyakogusa Predicted Gene
- Lj5g3v0977290.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0977290.1 Non Chatacterized Hit- tr|C0JP24|C0JP24_LOTJA
Putative basic helix-loop-helix protein BHLH6
OS=Lotus,48.65,5.9,seg,NULL,CUFF.54462.1
(283 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC69637 similar to UniRef100_A0CRQ4 Cluster: Chromosome... 153 7e-37
>gnl|LJGI|TC69637 similar to UniRef100_A0CRQ4 Cluster: Chromosome undetermined
scaffold_25, whole genome shotgun sequence; n=1;
Paramecium tetraurelia|Rep: Chromosome undetermined
scaffold_25, whole genome shotgun sequence - Paramecium
tetraurelia, partial (3%)
Length = 729
Score = 153 bits (77), Expect = 7e-37
Identities = 176/209 (84%)
Strand = Plus / Plus
Query: 61 aaaagttcgcagaggggaaggccaaagggcagcaaaaataaacctattgctttaccagat 120
||||| || ||||||||| |||| ||||| ||||||||||||||||| || || || |
Sbjct: 2 aaaagctcacagaggggacggcctaagggtagcaaaaataaacctatagcgttgccgatt 61
Query: 121 gattatctcgagccagtgacaggggaagatggggtgacaacacgcgcgcagcgagcttgg 180
|||| | | || ||||| ||||| || ||||| || ||||||||||||||||||||||||
Sbjct: 62 gattttttagaaccagttacaggtgaggatggcgtcacaacacgcgcgcagcgagcttgg 121
Query: 181 ttgcttggaaagaagttaggattaaaacctcgaggttctgaagcattgatgttgagagga 240
|||||||| || || ||||||||||||| || ||||| |||||| | |||||||||||
Sbjct: 122 ttgcttggtcaggagctaggattaaaaccgcgcggttcagaagcactaatgttgagaggt 181
Query: 241 ttggaagctcaaattcgtgaaaaccaccc 269
|||||||| ||||| |||||||| |||||
Sbjct: 182 ttggaagcccaaatccgtgaaaatcaccc 210