Miyakogusa Predicted Gene
- Lj4g3v2692410.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2692410.1 tr|B9N7R6|B9N7R6_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_828541 PE=4
SV=1,27.76,1e-18,FAMILY NOT NAMED,NULL; F-box,F-box domain,
cyclin-like; F-box domain,F-box domain, cyclin-like;
FBOX,gene.g57281.t1.1
(1113 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-lik... 84 2e-15
gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-li... 80 3e-14
gnl|LJGI|TC73420 weakly similar to UniRef100_A2Q574 Cluster: Cyc... 78 1e-13
gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosom... 66 5e-10
gnl|LJGI|BP071245 similar to UniRef100_A2Q574 Cluster: Cyclin-li... 66 5e-10
gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-li... 64 2e-09
gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyc... 58 1e-07
gnl|LJGI|TC65637 similar to UniRef100_A2Q574 Cluster: Cyclin-lik... 58 1e-07
gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-li... 56 5e-07
gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyc... 56 5e-07
gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cy... 54 2e-06
gnl|LJGI|FS344820 weakly similar to UniRef100_A2Q574 Cluster: Cy... 52 8e-06
>gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (6%)
Length = 881
Score = 83.8 bits (42), Expect = 2e-15
Identities = 54/58 (93%)
Strand = Plus / Plus
Query: 801 tgggagcaatctttcttccattgaacaagtgaatattaatgcagcaatttggtctgtt 858
||||||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||
Sbjct: 138 tgggagcaatctttcttcccttgaacaagtgaatattgatgcagaaattcggtctgtt 195
Score = 61.9 bits (31), Expect = 8e-09
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 1039 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatc 1098
|||||||||||| |||| |||||||| |||| ||| || || ||||| ||||||||||||
Sbjct: 520 atacctgatggagtagtggactttttacttcaaaactcgccgtccgctaaggttgacatc 579
Query: 1099 ata 1101
|||
Sbjct: 580 ata 582
>gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (14%)
Length = 508
Score = 79.8 bits (40), Expect = 3e-14
Identities = 115/140 (82%)
Strand = Plus / Plus
Query: 241 ttcaccaaatttttgtctaggcttttgactcttcgtgatggttcggccgcgctgcacgag 300
||||||||||| ||||| |||||||||||||||| ||||| ||| ||||||||||||
Sbjct: 332 ttcaccaaattcgtgtctcggcttttgactcttcgcgatggctcgaccgcgctgcacggt 391
Query: 301 ctccgtttctggcgcggtcgtcccatccagactcaactcctcaaaaggatggtaaaatat 360
|| ||| || | | ||| ||| ||| |||| |||||||||||||| |||||||||
Sbjct: 392 ctagattttgagcatgatggtcacattcagcctcacctcctcaaaaggattgtaaaatat 451
Query: 361 gttgtttcacacaatatcca 380
| ||||||||||||| ||||
Sbjct: 452 gctgtttcacacaatgtcca 471
>gnl|LJGI|TC73420 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (23%)
Length = 714
Score = 77.8 bits (39), Expect = 1e-13
Identities = 78/91 (85%)
Strand = Plus / Plus
Query: 97 tgcattctcctttacattctgtcatttttagccgccaaatctgcagttcaaacatgcatg 156
|||||||||||| ||||| |||||||| | |||||||| ||||||| ||||||||||
Sbjct: 222 tgcattctccttcacattttgtcatttctgagcgccaaatacgcagttcgaacatgcatg 281
Query: 157 ctatccacaagatggaagaatctttggaaac 187
|||||| |||||||||| |||| |||||||
Sbjct: 282 ttatccaaaagatggaaggatctctggaaac 312
>gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosome undetermined
scaffold_6, whole genome shotgun sequence; n=1;
Paramecium tetraurelia|Rep: Chromosome undetermined
scaffold_6, whole genome shotgun sequence - Paramecium
tetraurelia, partial (3%)
Length = 740
Score = 65.9 bits (33), Expect = 5e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 801 tgggagcaatctttcttccattgaacaagtgaatatt 837
||||||||||||||||||| |||||||||||||||||
Sbjct: 700 tgggagcaatctttcttcccttgaacaagtgaatatt 736
>gnl|LJGI|BP071245 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (13%)
Length = 552
Score = 65.9 bits (33), Expect = 5e-10
Identities = 90/109 (82%)
Strand = Plus / Plus
Query: 79 ctcagcgatttgcccgactgcattctcctttacattctgtcatttttagccgccaaatct 138
||||| || ||||| || ||| |||||||| |||||||||||||| | ||||| | |
Sbjct: 388 ctcagtgacttgcctgattgcgttctccttcacattctgtcatttgtgaatgccaagtat 447
Query: 139 gcagttcaaacatgcatgctatccacaagatggaagaatctttggaaac 187
||||||||||| |||| ||||||||||||||||| |||| |||||||
Sbjct: 448 gcagttcaaacttgcacattatccacaagatggaaggatctctggaaac 496
>gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
truncatula|Rep: Cyclin-like F-box - Medicago truncatula
(Barrel medic), partial (6%)
Length = 654
Score = 63.9 bits (32), Expect = 2e-09
Identities = 53/60 (88%)
Strand = Plus / Minus
Query: 1042 cctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatcata 1101
|||||||||||||| ||||||||| ||| |||||||||||| ||| | ||||| ||||||
Sbjct: 235 cctgatggaatagtggactttttgattcaaaattcaccatcagcagaagttgaaatcata 176
>gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (37%)
Length = 1467
Score = 58.0 bits (29), Expect = 1e-07
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 1037 ctatacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgaca 1096
||||||| ||||||| ||| |||| |||||||| ||| ||||| || || ||||||||||
Sbjct: 1201 ctataccggatggaacagtggactatttgcttcaaaactcaccctctgccaaggttgaca 1260
Query: 1097 tcata 1101
|||||
Sbjct: 1261 tcata 1265
Score = 52.0 bits (26), Expect = 8e-06
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 145 caaacatgcatgctatccacaagatggaagaatctttggaaacaacttccaggccttatt 204
||||||||| | |||||| |||||||||| ||||||||||||| || ||| |||||||
Sbjct: 302 caaacatgcgtattatccaaaagatggaaggatctttggaaacatctcccaacccttatt 361
Query: 205 tt 206
||
Sbjct: 362 tt 363
>gnl|LJGI|TC65637 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (13%)
Length = 732
Score = 58.0 bits (29), Expect = 1e-07
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 138 tgcagttcaaacatgcatgctatccacaagatggaagaatctttggaaa 186
|||||||||||| ||||| ||||||||||||||||| |||| ||||||
Sbjct: 319 tgcagttcaaacttgcatattatccacaagatggaaggatctatggaaa 367
>gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
truncatula|Rep: Cyclin-like F-box - Medicago truncatula
(Barrel medic), partial (5%)
Length = 536
Score = 56.0 bits (28), Expect = 5e-07
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 1039 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1094
||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 469 atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 414
>gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (14%)
Length = 718
Score = 56.0 bits (28), Expect = 5e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 1039 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1094
||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 343 atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 398
>gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (14%)
Length = 555
Score = 54.0 bits (27), Expect = 2e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 153 catgctatccacaagatggaagaatctttggaaac 187
|||| |||||||||||||||||||||| |||||||
Sbjct: 269 catgttatccacaagatggaagaatctctggaaac 303
>gnl|LJGI|FS344820 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (24%)
Length = 859
Score = 52.0 bits (26), Expect = 8e-06
Identities = 56/66 (84%)
Strand = Plus / Plus
Query: 130 gccaaatctgcagttcaaacatgcatgctatccacaagatggaagaatctttggaaacaa 189
||||||| ||||||||||||||| || |||| | ||||||||| |||| ||||||||
Sbjct: 234 gccaaatatgcagttcaaacatgtatcttatcggctagatggaaggatctctggaaacac 293
Query: 190 cttcca 195
||||||
Sbjct: 294 cttcca 299