Miyakogusa Predicted Gene

Lj4g3v2692410.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2692410.1 tr|B9N7R6|B9N7R6_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_828541 PE=4
SV=1,27.76,1e-18,FAMILY NOT NAMED,NULL; F-box,F-box domain,
cyclin-like; F-box domain,F-box domain, cyclin-like;
FBOX,gene.g57281.t1.1
         (1113 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-lik...    84   2e-15
gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-li...    80   3e-14
gnl|LJGI|TC73420 weakly similar to UniRef100_A2Q574 Cluster: Cyc...    78   1e-13
gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosom...    66   5e-10
gnl|LJGI|BP071245 similar to UniRef100_A2Q574 Cluster: Cyclin-li...    66   5e-10
gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-li...    64   2e-09
gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyc...    58   1e-07
gnl|LJGI|TC65637 similar to UniRef100_A2Q574 Cluster: Cyclin-lik...    58   1e-07
gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-li...    56   5e-07
gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyc...    56   5e-07
gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cy...    54   2e-06
gnl|LJGI|FS344820 weakly similar to UniRef100_A2Q574 Cluster: Cy...    52   8e-06

>gnl|LJGI|TC61828 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (6%)
          Length = 881

 Score = 83.8 bits (42), Expect = 2e-15
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                     
Query: 801 tgggagcaatctttcttccattgaacaagtgaatattaatgcagcaatttggtctgtt 858
           ||||||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||
Sbjct: 138 tgggagcaatctttcttcccttgaacaagtgaatattgatgcagaaattcggtctgtt 195



 Score = 61.9 bits (31), Expect = 8e-09
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1039 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatc 1098
            |||||||||||| |||| |||||||| |||| ||| || || ||||| ||||||||||||
Sbjct: 520  atacctgatggagtagtggactttttacttcaaaactcgccgtccgctaaggttgacatc 579

               
Query: 1099 ata 1101
            |||
Sbjct: 580  ata 582


>gnl|LJGI|BP063614 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (14%)
          Length = 508

 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 115/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 241 ttcaccaaatttttgtctaggcttttgactcttcgtgatggttcggccgcgctgcacgag 300
           |||||||||||  ||||| |||||||||||||||| ||||| ||| ||||||||||||  
Sbjct: 332 ttcaccaaattcgtgtctcggcttttgactcttcgcgatggctcgaccgcgctgcacggt 391

                                                                       
Query: 301 ctccgtttctggcgcggtcgtcccatccagactcaactcctcaaaaggatggtaaaatat 360
           ||   |||   ||  | | ||| ||| ||| |||| |||||||||||||| |||||||||
Sbjct: 392 ctagattttgagcatgatggtcacattcagcctcacctcctcaaaaggattgtaaaatat 451

                               
Query: 361 gttgtttcacacaatatcca 380
           | ||||||||||||| ||||
Sbjct: 452 gctgtttcacacaatgtcca 471


>gnl|LJGI|TC73420 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (23%)
          Length = 714

 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                       
Query: 97  tgcattctcctttacattctgtcatttttagccgccaaatctgcagttcaaacatgcatg 156
           |||||||||||| ||||| |||||||| |   ||||||||  ||||||| ||||||||||
Sbjct: 222 tgcattctccttcacattttgtcatttctgagcgccaaatacgcagttcgaacatgcatg 281

                                          
Query: 157 ctatccacaagatggaagaatctttggaaac 187
            |||||| |||||||||| |||| |||||||
Sbjct: 282 ttatccaaaagatggaaggatctctggaaac 312


>gnl|LJGI|FS338181 similar to UniRef100_A0DQC5 Cluster: Chromosome undetermined
           scaffold_6, whole genome shotgun sequence; n=1;
           Paramecium tetraurelia|Rep: Chromosome undetermined
           scaffold_6, whole genome shotgun sequence - Paramecium
           tetraurelia, partial (3%)
          Length = 740

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 801 tgggagcaatctttcttccattgaacaagtgaatatt 837
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 700 tgggagcaatctttcttcccttgaacaagtgaatatt 736


>gnl|LJGI|BP071245 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (13%)
          Length = 552

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 79  ctcagcgatttgcccgactgcattctcctttacattctgtcatttttagccgccaaatct 138
           ||||| || ||||| || ||| |||||||| |||||||||||||| |    ||||| | |
Sbjct: 388 ctcagtgacttgcctgattgcgttctccttcacattctgtcatttgtgaatgccaagtat 447

                                                            
Query: 139 gcagttcaaacatgcatgctatccacaagatggaagaatctttggaaac 187
           ||||||||||| ||||   ||||||||||||||||| |||| |||||||
Sbjct: 448 gcagttcaaacttgcacattatccacaagatggaaggatctctggaaac 496


>gnl|LJGI|FS355262 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
            truncatula|Rep: Cyclin-like F-box - Medicago truncatula
            (Barrel medic), partial (6%)
          Length = 654

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 1042 cctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgacatcata 1101
            |||||||||||||| ||||||||| ||| |||||||||||| ||| | ||||| ||||||
Sbjct: 235  cctgatggaatagtggactttttgattcaaaattcaccatcagcagaagttgaaatcata 176


>gnl|LJGI|TC72353 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
            Medicago truncatula|Rep: Cyclin-like F-box - Medicago
            truncatula (Barrel medic), partial (37%)
          Length = 1467

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1037 ctatacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttgaca 1096
            ||||||| ||||||| ||| |||| |||||||| ||| ||||| || || ||||||||||
Sbjct: 1201 ctataccggatggaacagtggactatttgcttcaaaactcaccctctgccaaggttgaca 1260

                 
Query: 1097 tcata 1101
            |||||
Sbjct: 1261 tcata 1265



 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 145 caaacatgcatgctatccacaagatggaagaatctttggaaacaacttccaggccttatt 204
           ||||||||| |  |||||| |||||||||| ||||||||||||| || |||  |||||||
Sbjct: 302 caaacatgcgtattatccaaaagatggaaggatctttggaaacatctcccaacccttatt 361

             
Query: 205 tt 206
           ||
Sbjct: 362 tt 363


>gnl|LJGI|TC65637 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (13%)
          Length = 732

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 138 tgcagttcaaacatgcatgctatccacaagatggaagaatctttggaaa 186
           |||||||||||| |||||  ||||||||||||||||| |||| ||||||
Sbjct: 319 tgcagttcaaacttgcatattatccacaagatggaaggatctatggaaa 367


>gnl|LJGI|FS347988 similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1; Medicago
            truncatula|Rep: Cyclin-like F-box - Medicago truncatula
            (Barrel medic), partial (5%)
          Length = 536

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 1039 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1094
            ||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 469  atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 414


>gnl|LJGI|TC75251 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
            Medicago truncatula|Rep: Cyclin-like F-box - Medicago
            truncatula (Barrel medic), partial (14%)
          Length = 718

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 1039 atacctgatggaatagtagactttttgcttcgaaattcaccatccgcaaaggttga 1094
            ||||||| ||||||||| ||||||||||||| ||| |||||| | ||||| |||||
Sbjct: 343  atacctgctggaatagtggactttttgcttcaaaactcaccaacagcaaaagttga 398


>gnl|LJGI|GO023715 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (14%)
          Length = 555

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 153 catgctatccacaagatggaagaatctttggaaac 187
           |||| |||||||||||||||||||||| |||||||
Sbjct: 269 catgttatccacaagatggaagaatctctggaaac 303


>gnl|LJGI|FS344820 weakly similar to UniRef100_A2Q574 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (24%)
          Length = 859

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 gccaaatctgcagttcaaacatgcatgctatccacaagatggaagaatctttggaaacaa 189
           ||||||| ||||||||||||||| ||  ||||  | ||||||||| |||| |||||||| 
Sbjct: 234 gccaaatatgcagttcaaacatgtatcttatcggctagatggaaggatctctggaaacac 293

                 
Query: 190 cttcca 195
           ||||||
Sbjct: 294 cttcca 299