Miyakogusa Predicted Gene

Lj4g3v2140320.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2140320.1 Non Chatacterized Hit- tr|I1GXU4|I1GXU4_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,41.72,1e-18,zinc finger binding to DNA consensus sequenc,Zinc
finger, GATA-type; GATA,Zinc finger, GATA-type; SU,CUFF.50368.1
         (978 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59253 similar to UniRef100_Q5HZ36 Cluster: GATA trans...   141   9e-33

>gnl|LJGI|TC59253 similar to UniRef100_Q5HZ36 Cluster: GATA transcription factor 24;
           n=2; Arabidopsis thaliana|Rep: GATA transcription factor
           24 - Arabidopsis thaliana (Mouse-ear cress), partial
           (17%)
          Length = 1110

 Score =  141 bits (71), Expect = 9e-33
 Identities = 107/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 548 ctgttagggtttgtgctgattgcaacaccactaagacacctctctggagaagtggaccaa 607
           ||||||||||||||||||||||||||||||| ||||| |||||||||||  |||||||||
Sbjct: 696 ctgttagggtttgtgctgattgcaacaccaccaagacccctctctggaggggtggaccaa 755

                                                                      
Query: 608 gaggccccaagtctctttgcaacgcatgtgggatcagacaaaggaaggcaagacgtgcc 666
           |||| |||||| | ||||||||||| ||||||||  |||||||||| || |||||||||
Sbjct: 756 gaggtcccaagacactttgcaacgcctgtgggattcgacaaaggaaagcgagacgtgcc 814



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 916  caggatgagaaggaggcagcgatattgctcatggctttgtcttatggc 963
            |||||||||||||| || || || |||||||||||||||||| |||||
Sbjct: 1028 caggatgagaaggatgctgcaatcttgctcatggctttgtctcatggc 1075