Miyakogusa Predicted Gene

Lj4g3v2046240.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2046240.1 Non Chatacterized Hit- tr|Q5J7B4|Q5J7B4_GINBI
Putative 1-D-deoxyxylulose 5-phosphate synthase
OS=Gin,78.57,0.000002,Thiamin diphosphate-binding fold
(THDP-binding),NULL; DXP_synthase_N,Deoxyxylulose-5-phosphate
synth,CUFF.50184.1
         (390 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82026 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-...    62   3e-09
gnl|LJGI|TC58045 homologue to UniRef100_Q8L692 Cluster: 1-deoxy-...    56   2e-07
gnl|LJGI|GO020915 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D...    52   3e-06

>gnl|LJGI|TC82026 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-D-xylulose
           5-phosphate synthase; n=1; Pueraria montana var.
           lobata|Rep: 1-deoxy-D-xylulose 5-phosphate synthase -
           Pueraria lobata (Kudzu vine), partial (41%)
          Length = 1218

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 340 ggtgacggagccatgacagctggacaagcgtacgaagccatgaacaatgct 390
           ||||| || |||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 844 ggtgatggtgccatgacagctggtcaagcttatgaagccatgaacaatgct 894


>gnl|LJGI|TC58045 homologue to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose
           5-phosphate synthase 2 precursor; n=1; Medicago
           truncatula|Rep: 1-deoxy-D-xylulose 5-phosphate synthase
           2 precursor - Medicago truncatula (Barrel medic),
           partial (32%)
          Length = 831

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 208 tttcccaagagggacgagagtgttcatgatgcttttggggttggtcatagttctactagc 267
           ||||| || ||||| |||||  ||||||||||||||||||  || || |||||||| |||
Sbjct: 526 tttccgaaaagggatgagagcattcatgatgcttttggggcaggacacagttctacaagc 585

                                           
Query: 268 atttcagctgccttaggtatggcagttgcaag 299
           || |||||||   | || ||||||||||||||
Sbjct: 586 atatcagctggtcttggcatggcagttgcaag 617


>gnl|LJGI|GO020915 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
           synthase 2 precursor; n=1; Medicago truncatula|Rep:
           1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
           Medicago truncatula (Barrel medic), partial (15%)
          Length = 330

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 208 tttcccaagagggacgagagtgttcatgatgcttttggggttggtcatagttctactagc 267
           ||||| || ||||| |||||  |||||||||||||||| || || ||||||||||| |||
Sbjct: 236 tttcctaaaagggatgagagcattcatgatgcttttggagtaggacatagttctacaagc 295

             
Query: 268 at 269
           ||
Sbjct: 296 at 297