Miyakogusa Predicted Gene
- Lj4g3v2046240.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2046240.1 Non Chatacterized Hit- tr|Q5J7B4|Q5J7B4_GINBI
Putative 1-D-deoxyxylulose 5-phosphate synthase
OS=Gin,78.57,0.000002,Thiamin diphosphate-binding fold
(THDP-binding),NULL; DXP_synthase_N,Deoxyxylulose-5-phosphate
synth,CUFF.50184.1
(390 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC82026 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-... 62 3e-09
gnl|LJGI|TC58045 homologue to UniRef100_Q8L692 Cluster: 1-deoxy-... 56 2e-07
gnl|LJGI|GO020915 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D... 52 3e-06
>gnl|LJGI|TC82026 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-D-xylulose
5-phosphate synthase; n=1; Pueraria montana var.
lobata|Rep: 1-deoxy-D-xylulose 5-phosphate synthase -
Pueraria lobata (Kudzu vine), partial (41%)
Length = 1218
Score = 61.9 bits (31), Expect = 3e-09
Identities = 46/51 (90%)
Strand = Plus / Plus
Query: 340 ggtgacggagccatgacagctggacaagcgtacgaagccatgaacaatgct 390
||||| || |||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 844 ggtgatggtgccatgacagctggtcaagcttatgaagccatgaacaatgct 894
>gnl|LJGI|TC58045 homologue to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose
5-phosphate synthase 2 precursor; n=1; Medicago
truncatula|Rep: 1-deoxy-D-xylulose 5-phosphate synthase
2 precursor - Medicago truncatula (Barrel medic),
partial (32%)
Length = 831
Score = 56.0 bits (28), Expect = 2e-07
Identities = 76/92 (82%)
Strand = Plus / Plus
Query: 208 tttcccaagagggacgagagtgttcatgatgcttttggggttggtcatagttctactagc 267
||||| || ||||| ||||| |||||||||||||||||| || || |||||||| |||
Sbjct: 526 tttccgaaaagggatgagagcattcatgatgcttttggggcaggacacagttctacaagc 585
Query: 268 atttcagctgccttaggtatggcagttgcaag 299
|| ||||||| | || ||||||||||||||
Sbjct: 586 atatcagctggtcttggcatggcagttgcaag 617
>gnl|LJGI|GO020915 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
synthase 2 precursor; n=1; Medicago truncatula|Rep:
1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
Medicago truncatula (Barrel medic), partial (15%)
Length = 330
Score = 52.0 bits (26), Expect = 3e-06
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 208 tttcccaagagggacgagagtgttcatgatgcttttggggttggtcatagttctactagc 267
||||| || ||||| ||||| |||||||||||||||| || || ||||||||||| |||
Sbjct: 236 tttcctaaaagggatgagagcattcatgatgcttttggagtaggacatagttctacaagc 295
Query: 268 at 269
||
Sbjct: 296 at 297