Miyakogusa Predicted Gene

Lj4g3v1388950.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1388950.1 Non Chatacterized Hit- tr|I1QAY8|I1QAY8_ORYGL
Uncharacterized protein OS=Oryza glaberrima PE=4
SV=1,56.41,2e-17,BROMODOMAIN-CONTAINING PROTEIN,NULL; FALZ-RELATED
BROMODOMAIN-CONTAINING PROTEINS,NULL; Bromodomain,,CUFF.49137.1
         (2217 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67288 similar to UniRef100_A7PHD1 Cluster: Chromosome...   672   0.0  
gnl|LJGI|TC74209 similar to UniRef100_A7PHD1 Cluster: Chromosome...   254   2e-66

>gnl|LJGI|TC67288 similar to UniRef100_A7PHD1 Cluster: Chromosome chr17 scaffold_16,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr17 scaffold_16, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (16%)
          Length = 780

 Score =  672 bits (339), Expect = 0.0
 Identities = 339/339 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1879 cctgaaaaacttaggatggaacgagaagagctcgagagacggaagaaggaagagaaagcg 1938
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    cctgaaaaacttaggatggaacgagaagagctcgagagacggaagaaggaagagaaagcg 60

                                                                        
Query: 1939 cggttgaaggctgaggcaaaggctgcagaagaggctcagaggaaagctgaagcaaaagct 1998
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   cggttgaaggctgaggcaaaggctgcagaagaggctcagaggaaagctgaagcaaaagct 120

                                                                        
Query: 1999 gcagctgaagctaaaaggaggagagaactggagagggaagaggctcgtcaggccttgcaa 2058
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121  gcagctgaagctaaaaggaggagagaactggagagggaagaggctcgtcaggccttgcaa 180

                                                                        
Query: 2059 aagatggagaagactgtagatatcaatgagagcagtcaattcttggaagatctagagatg 2118
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181  aagatggagaagactgtagatatcaatgagagcagtcaattcttggaagatctagagatg 240

                                                                        
Query: 2119 ctgagtggtgtacaagatgaacctttaataagtttcgctgaagagtcaagcccagatcgt 2178
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241  ctgagtggtgtacaagatgaacctttaataagtttcgctgaagagtcaagcccagatcgt 300

                                                   
Query: 2179 cctcaaaatggactgggttctttcaaacgacagggtagt 2217
            |||||||||||||||||||||||||||||||||||||||
Sbjct: 301  cctcaaaatggactgggttctttcaaacgacagggtagt 339


>gnl|LJGI|TC74209 similar to UniRef100_A7PHD1 Cluster: Chromosome chr17 scaffold_16,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr17 scaffold_16, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (26%)
          Length = 705

 Score =  254 bits (128), Expect = 2e-66
 Identities = 242/280 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1730 cagaaagccatcaagagggggagagtgctccatctaagaggcaagtctctcccgataagc 1789
            |||||| |||||||||||||||||| ||| ||||||||||||||||||||||||| ||||
Sbjct: 411  cagaaatccatcaagagggggagagcgctgcatctaagaggcaagtctctcccgaaaagc 470

                                                                        
Query: 1790 tttaccgtgcagcattattaaggagcagatttgctgacactatacttaaagctcaagaaa 1849
            | ||||||||||| ||||| |||||| | ||||||||||| ||||||||||||| ||| |
Sbjct: 471  tctaccgtgcagctttattgaggagccggtttgctgacaccatacttaaagctcgagaga 530

                                                                        
Query: 1850 aggcacttgagaagggtgagaagcaggaccctgaaaaacttaggatggaacgagaagagc 1909
            | |||||||| |||| ||| |||| ||| ||||||||||| | ||| || |||||||| |
Sbjct: 531  aagcacttgaaaaggatgaaaagcgggatcctgaaaaactcaagatagagcgagaagatc 590

                                                                        
Query: 1910 tcgagagacggaagaaggaagagaaagcgcggttgaaggctgaggcaaaggctgcagaag 1969
            | |||||  || |||||||||||||||| ||  |  |||| |||||||||||||||||||
Sbjct: 591  ttgagaggaggcagaaggaagagaaagctcgacttcaggcagaggcaaaggctgcagaag 650

                                                    
Query: 1970 aggctcagaggaaagctgaagcaaaagctgcagctgaagc 2009
              |||||||||||||| |||| | ||||||||||||||||
Sbjct: 651  cagctcagaggaaagcagaagaagaagctgcagctgaagc 690



 Score = 89.7 bits (45), Expect = 7e-17
 Identities = 146/180 (81%), Gaps = 6/180 (3%)
 Strand = Plus / Plus

                                                                        
Query: 1361 tgcaacaatgtaaaggcaatgaaccagttgaagaggacatagatattgttggggggaatg 1420
            ||||||||||||||||||| |||| |||||| |||||  | || |||||||| |||||||
Sbjct: 30   tgcaacaatgtaaaggcaacgaacaagttgaggaggatgtggacattgttggtgggaatg 89

                                                                        
Query: 1421 atcctcctctttcaagttaccctccagtggagatt------gatgtcaccaacaaagaca 1474
            |||||||| ||||||  ||||||| | | ||||||      |||| |||||| |   |||
Sbjct: 90   atcctcctatttcaaactaccctctactagagattgagaaagatggcaccaataggaaca 149

                                                                        
Query: 1475 gtaaatccagtagttctagcagctccagcagcgattctggctcttcatccagtgattcag 1534
             ||||| ||||||||| ||||||||||| || || ||||||||  |||||||||| ||||
Sbjct: 150  ataaatgcagtagttcaagcagctccagtagtgaatctggctcaacatccagtgactcag 209