Miyakogusa Predicted Gene

Lj4g3v0620590.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0620590.1 tr|G7KGG1|G7KGG1_MEDTR MADS-box protein
OS=Medicago truncatula GN=MTR_5g031000 PE=3 SV=1,29.23,9.7,
,CUFF.47688.1
         (279 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58991 homologue to UniRef100_Q39879 Cluster: Mitotic ...    56   1e-07

>gnl|LJGI|TC58991 homologue to UniRef100_Q39879 Cluster: Mitotic cyclin a2-type; n=1;
           Glycine max|Rep: Mitotic cyclin a2-type - Glycine max
           (Soybean), partial (49%)
          Length = 872

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 75/90 (83%), Gaps = 8/90 (8%)
 Strand = Plus / Plus

                                                                       
Query: 190 caactagagagcttgacaaactatattgccgctcgaattgtctctcatggagaacagcat 249
           ||||| ||||| ||||||||||| |||||||    ||||||||||||||||| |||||||
Sbjct: 378 caacttgagagtttgacaaactacattgccg----aattgtctctcatggagtacagcat 433

                                         
Query: 250 atatactttgttatgctccattacttgtag 279
                ||||||||||| |||| ||||||||
Sbjct: 434 g----ctttgttatgcaccatcacttgtag 459