Miyakogusa Predicted Gene

Lj3g3v2004950.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2004950.1 Non Chatacterized Hit- tr|F6HTB1|F6HTB1_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,60.53,0.008,seg,NULL,CUFF.43520.1
         (196 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012271 homologue to UniRef100_Q93ZB1 Cluster: At1g325...   254   2e-67
gnl|LJGI|TC61295 homologue to UniRef100_Q93ZB1 Cluster: At1g3254...   125   1e-28
gnl|LJGI|GO021521 homologue to UniRef100_Q53UG6 Cluster: LSD-One...    52   1e-06
gnl|LJGI|BP049974 homologue to UniRef100_Q53UG6 Cluster: LSD-One...    52   1e-06

>gnl|LJGI|GO012271 homologue to UniRef100_Q93ZB1 Cluster: At1g32540/T9G5_1; n=1;
           Arabidopsis thaliana|Rep: At1g32540/T9G5_1 - Arabidopsis
           thaliana (Mouse-ear cress), partial (64%)
          Length = 747

 Score =  254 bits (128), Expect = 2e-67
 Identities = 128/128 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgccagttccacttgccccctaccctactccaccagctccatacacaccaccaacaaac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 atgccagttccacttgccccctaccctactccaccagctccatacacaccaccaacaaac 196

                                                                       
Query: 61  ggtatcttgcttgacctgtgcttgatttgctcattcatgcgtgttctctatttgaattct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 ggtatcttgcttgacctgtgcttgatttgctcattcatgcgtgttctctatttgaattct 256

                   
Query: 121 tatcaagg 128
           ||||||||
Sbjct: 257 tatcaagg 264


>gnl|LJGI|TC61295 homologue to UniRef100_Q93ZB1 Cluster: At1g32540/T9G5_1; n=1;
           Arabidopsis thaliana|Rep: At1g32540/T9G5_1 - Arabidopsis
           thaliana (Mouse-ear cress), partial (88%)
          Length = 858

 Score =  125 bits (63), Expect = 1e-28
 Identities = 63/63 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgccagttccacttgccccctaccctactccaccagctccatacacaccaccaacaaac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 213 atgccagttccacttgccccctaccctactccaccagctccatacacaccaccaacaaac 272

              
Query: 61  ggt 63
           |||
Sbjct: 273 ggt 275


>gnl|LJGI|GO021521 homologue to UniRef100_Q53UG6 Cluster: LSD-One-Like 1; n=1;
           Brassica rapa|Rep: LSD-One-Like 1 - Brassica campestris
           (Field mustard), partial (53%)
          Length = 731

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 1   atgccagttccacttgccccctaccc 26
           ||||||||||||||||||||||||||
Sbjct: 442 atgccagttccacttgccccctaccc 467


>gnl|LJGI|BP049974 homologue to UniRef100_Q53UG6 Cluster: LSD-One-Like 1; n=1;
           Brassica rapa|Rep: LSD-One-Like 1 - Brassica campestris
           (Field mustard), partial (65%)
          Length = 592

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 1   atgccagttccacttgccccctaccc 26
           ||||||||||||||||||||||||||
Sbjct: 263 atgccagttccacttgccccctaccc 288