Miyakogusa Predicted Gene

Lj3g3v0797350.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0797350.1 Non Chatacterized Hit- tr|K3ZJA8|K3ZJA8_SETIT
Uncharacterized protein OS=Setaria italica
GN=Si026661,37.75,6e-19,DUF1191,Protein of unknown function
DUF1191,CUFF.41400.1
         (582 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68135 similar to UniRef100_Q94B60 Cluster: ATP-depend...    98   7e-20
gnl|LJGI|AV769456 similar to UniRef100_A7QKC8 Cluster: Chromosom...    62   4e-09

>gnl|LJGI|TC68135 similar to UniRef100_Q94B60 Cluster: ATP-dependent Clp protease
           proteolytic subunit 4, chloroplast precursor; n=1;
           Arabidopsis thaliana|Rep: ATP-dependent Clp protease
           proteolytic subunit 4, chloroplast precursor -
           Arabidopsis thaliana (Mouse-ear cress), partial (80%)
          Length = 1262

 Score = 97.6 bits (49), Expect = 7e-20
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgctcaagacccctgtaaagatatcaagcttttcatttattcacctggtggctctctca 60
           ||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||
Sbjct: 416 atgctcaagacccctctaaagatatcaagcttttcattaattcccctggtggctctctca 475

            
Query: 61  g 61
           |
Sbjct: 476 g 476


>gnl|LJGI|AV769456 similar to UniRef100_A7QKC8 Cluster: Chromosome chr2 scaffold_112,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr2 scaffold_112, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (30%)
          Length = 523

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 552 attgtgtgccagttttgaaggggatgggaga 582
           |||||||||||||||||||||||||||||||
Sbjct: 523 attgtgtgccagttttgaaggggatgggaga 493