Miyakogusa Predicted Gene
- Lj3g3v0277880.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v0277880.1 Non Chatacterized Hit- tr|A2ZQ50|A2ZQ50_ORYSJ
Putative uncharacterized protein OS=Oryza sativa
subsp,61.67,0.00003,Homeodomain-like,Homeodomain-like; SANT SWI3,
ADA2, N-CoR and TFIIIB'' DNA-bin,SANT/Myb domain; Myb,CUFF.40420.1
(1050 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC73393 similar to UniRef100_Q2LMD7 Cluster: MYBR2; n=1... 589 e-167
gnl|LJGI|TC76820 similar to UniRef100_Q0PJL8 Cluster: MYB transc... 569 e-161
gnl|LJGI|TC69586 homologue to UniRef100_Q0PJJ8 Cluster: MYB tran... 70 3e-11
gnl|LJGI|TC57512 similar to UniRef100_Q0PJJ8 Cluster: MYB transc... 70 3e-11
gnl|LJGI|GO010963 similar to UniRef100_Q0PJL5 Cluster: MYB trans... 60 3e-08
>gnl|LJGI|TC73393 similar to UniRef100_Q2LMD7 Cluster: MYBR2; n=1; Malus x
domestica|Rep: MYBR2 - Malus domestica (Apple) (Malus
sylvestris), partial (34%)
Length = 504
Score = 589 bits (297), Expect = e-167
Identities = 297/297 (100%)
Strand = Plus / Plus
Query: 114 agtgaagctttttggggtgaggctaacggatggaccgattatcaagaagagcgctagcat 173
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 agtgaagctttttggggtgaggctaacggatggaccgattatcaagaagagcgctagcat 267
Query: 174 ggggagcctcaccctctcctccgctcatcaccattattcttcttcctctgacccgcctca 233
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 ggggagcctcaccctctcctccgctcatcaccattattcttcttcctctgacccgcctca 327
Query: 234 tgagcccgacgagtacttgtccgatgaccctgcccatgcttccaccttcgctaaccgccg 293
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 tgagcccgacgagtacttgtccgatgaccctgcccatgcttccaccttcgctaaccgccg 387
Query: 294 tggagaaaggaagaaaggtgttccatggactgaagaagaacatcgactgttcttaattgg 353
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 tggagaaaggaagaaaggtgttccatggactgaagaagaacatcgactgttcttaattgg 447
Query: 354 tctccagaagttgggcaaaggagattggcgtgggatagcacgtaattttgttgtctc 410
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 448 tctccagaagttgggcaaaggagattggcgtgggatagcacgtaattttgttgtctc 504
Score = 127 bits (64), Expect = 2e-28
Identities = 64/64 (100%)
Strand = Plus / Plus
Query: 1 atgggtcgacggtgctcccactgcagcaaagagaaccacaattcccgaacctgcccctcc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113 atgggtcgacggtgctcccactgcagcaaagagaaccacaattcccgaacctgcccctcc 172
Query: 61 cgcg 64
||||
Sbjct: 173 cgcg 176
>gnl|LJGI|TC76820 similar to UniRef100_Q0PJL8 Cluster: MYB transcription factor MYB52;
n=1; Glycine max|Rep: MYB transcription factor MYB52 -
Glycine max (Soybean), partial (25%)
Length = 733
Score = 569 bits (287), Expect = e-161
Identities = 287/287 (100%)
Strand = Plus / Plus
Query: 764 catcaatcgcagctccttgtgaagaagttaacagaggagtgacatttcatcatgagatct 823
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 catcaatcgcagctccttgtgaagaagttaacagaggagtgacatttcatcatgagatct 60
Query: 824 tgaagccaatcccggtcatccctaaggaacctgtcaatgttgatgaacttgtgggattgt 883
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 tgaagccaatcccggtcatccctaaggaacctgtcaatgttgatgaacttgtgggattgt 120
Query: 884 ctcatctgagcattggggaaacacaggtacgtgatcgagagccttccccactttccttaa 943
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ctcatctgagcattggggaaacacaggtacgtgatcgagagccttccccactttccttaa 180
Query: 944 agttgttaggagagccctcaaggcagtcagcattccatgcaaatgctccggttagtagtt 1003
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 agttgttaggagagccctcaaggcagtcagcattccatgcaaatgctccggttagtagtt 240
Query: 1004 cggatttaaacagtggcaagaacagcgccatacaagcagtctgagct 1050
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 cggatttaaacagtggcaagaacagcgccatacaagcagtctgagct 287
>gnl|LJGI|TC69586 homologue to UniRef100_Q0PJJ8 Cluster: MYB transcription factor
MYB93; n=1; Glycine max|Rep: MYB transcription factor
MYB93 - Glycine max (Soybean), partial (46%)
Length = 656
Score = 69.9 bits (35), Expect = 3e-11
Identities = 110/135 (81%)
Strand = Plus / Plus
Query: 315 tccatggactgaagaagaacatcgactgttcttaattggtctccagaagttgggcaaagg 374
|||||||||||| || ||||| || |||| ||| |||| | ||||| ||||||||||
Sbjct: 488 tccatggactgaggaggaacacagaatgtttttacttggattgcagaaactgggcaaagg 547
Query: 375 agattggcgtgggatagcacgtaattttgttgtctcaaggacccctactcaagtagcaag 434
||||||||||| || ||| | || | |||| | |||||||| ||||||||||| || ||
Sbjct: 548 tgattggcgtggaattgcaaggaactatgttatttcaaggacacctactcaagtggccag 607
Query: 435 tcatgcccagaaata 449
|||||| ||||||||
Sbjct: 608 tcatgctcagaaata 622
>gnl|LJGI|TC57512 similar to UniRef100_Q0PJJ8 Cluster: MYB transcription factor
MYB93; n=1; Glycine max|Rep: MYB transcription factor
MYB93 - Glycine max (Soybean), partial (95%)
Length = 1427
Score = 69.9 bits (35), Expect = 3e-11
Identities = 110/135 (81%)
Strand = Plus / Plus
Query: 315 tccatggactgaagaagaacatcgactgttcttaattggtctccagaagttgggcaaagg 374
|||||||||||| || ||||| || |||| ||| |||| | ||||| ||||||||||
Sbjct: 400 tccatggactgaggaggaacacagaatgtttttacttggattgcagaaactgggcaaagg 459
Query: 375 agattggcgtgggatagcacgtaattttgttgtctcaaggacccctactcaagtagcaag 434
||||||||||| || ||| | || | |||| | |||||||| ||||||||||| || ||
Sbjct: 460 tgattggcgtggaattgcaaggaactatgttatttcaaggacacctactcaagtggccag 519
Query: 435 tcatgcccagaaata 449
|||||| ||||||||
Sbjct: 520 tcatgctcagaaata 534
>gnl|LJGI|GO010963 similar to UniRef100_Q0PJL5 Cluster: MYB transcription factor
MYB57; n=1; Glycine max|Rep: MYB transcription factor
MYB57 - Glycine max (Soybean), partial (46%)
Length = 569
Score = 60.0 bits (30), Expect = 3e-08
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 298 gaaaggaagaaaggtgttccatggactgaagaagaaca 335
||||||||||||||||| |||||||||||||| |||||
Sbjct: 444 gaaaggaagaaaggtgtgccatggactgaagaggaaca 481