Miyakogusa Predicted Gene
- Lj2g3v2197680.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v2197680.1 Non Chatacterized Hit- tr|J3N0A4|J3N0A4_ORYBR
Uncharacterized protein OS=Oryza brachyantha
GN=OB09G2,87.04,1e-17,Ubiquitin homologues,Ubiquitin;
UBIQUITIN_2,Ubiquitin supergroup; ubiquitin,Ubiquitin;
Ubiquitin-lik,CUFF.38727.1
(165 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ... 188 7e-48
gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubi... 157 2e-38
gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ... 157 2e-38
gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ... 157 2e-38
gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension ... 125 9e-29
gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein... 125 9e-29
gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ... 117 2e-26
gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 117 2e-26
gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 117 2e-26
gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ... 78 2e-14
gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot... 68 2e-11
gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiq... 64 3e-10
gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromoso... 64 3e-10
gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 62 1e-09
gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T... 60 4e-09
gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein... 56 7e-08
>gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
thaliana (Mouse-ear cress), partial (80%)
Length = 1160
Score = 188 bits (95), Expect = 7e-48
Identities = 125/135 (92%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||
Sbjct: 86 atgcagatctttgtgaaaactctgaccggcaagaccatcaccttagaggtggagagttca 145
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
|||||||||||||| | ||||||||||||||| |||||||||||||||||| ||||||||
Sbjct: 146 gataccattgataatgtaaaagccaagatccaggataaggaagggatcccacctgatcag 205
Query: 121 caaaggttcatcttt 135
|||||| | ||||||
Sbjct: 206 caaaggcttatcttt 220
Score = 52.0 bits (26), Expect = 1e-06
Identities = 92/114 (80%)
Strand = Plus / Plus
Query: 22 ttgaccggcaagaccatcaccttggaggtggagagttcagataccattgataacgcaaaa 81
||||| || ||||| || || ||||||||||| || |||||||| |||||||| | |||
Sbjct: 563 ttgacaggaaagacaataacgttggaggtggaaagctcagatactattgataatgtgaaa 622
Query: 82 gccaagatccaagataaggaagggatcccagctgatcagcaaaggttcatcttt 135
|||||||| || || ||||| || ||||| | || ||||| ||| ||||||||
Sbjct: 623 gccaagattcaggacaaggagggcatcccgccagaccagcagaggctcatcttt 676
>gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (31%)
Length = 486
Score = 157 bits (79), Expect = 2e-38
Identities = 121/135 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||| |||||| ||||||| ||||| ||||||||||||||| | |||||||||||||||
Sbjct: 128 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 187
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| || | ||||||||||||||||| ||||||||||||||| ||||||||
Sbjct: 188 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 247
Query: 121 caaaggttcatcttt 135
|||||| | ||||||
Sbjct: 248 caaaggcttatcttt 262
>gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (33%)
Length = 510
Score = 157 bits (79), Expect = 2e-38
Identities = 121/135 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||| |||||| ||||||| ||||| ||||||||||||||| | |||||||||||||||
Sbjct: 133 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 192
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| || | ||||||||||||||||| ||||||||||||||| ||||||||
Sbjct: 193 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 252
Query: 121 caaaggttcatcttt 135
|||||| | ||||||
Sbjct: 253 caaaggcttatcttt 267
>gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
thaliana (Mouse-ear cress), complete
Length = 1468
Score = 157 bits (79), Expect = 2e-38
Identities = 121/135 (89%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||| |||||| ||||||| ||||| ||||||||||||||| | |||||||||||||||
Sbjct: 104 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 163
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| || | ||||||||||||||||| ||||||||||||||| ||||||||
Sbjct: 164 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 223
Query: 121 caaaggttcatcttt 135
|||||| | ||||||
Sbjct: 224 caaaggcttatcttt 238
Score = 73.8 bits (37), Expect = 3e-13
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 22 ttgaccggcaagaccatcaccttggaggtggagagttcagataccattgataa 74
||||| || ||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 581 ttgacagggaagaccatcactttggaggtggagagttctgataccattgataa 633
>gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
eudicotyledons|Rep: Ubiquitin extension protein -
Capsicum annuum (Bell pepper), partial (42%)
Length = 361
Score = 125 bits (63), Expect = 9e-29
Identities = 117/135 (86%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||| |||||| ||||||| | ||||| ||||| ||||| | ||||| |||||||||
Sbjct: 135 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 194
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| |||| ||||| ||||||||||| ||||||||||||||| ||||||||
Sbjct: 195 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 254
Query: 121 caaaggttcatcttt 135
|||||||| ||||||
Sbjct: 255 caaaggttgatcttt 269
>gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
annuus|Rep: Hexaubiquitin protein - Helianthus annuus
(Common sunflower), complete
Length = 1704
Score = 125 bits (63), Expect = 9e-29
Identities = 117/135 (86%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||| |||||| ||||||| | ||||| ||||| ||||| | ||||| |||||||||
Sbjct: 97 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 156
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| |||| ||||| ||||||||||| ||||||||||||||| ||||||||
Sbjct: 157 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 216
Query: 121 caaaggttcatcttt 135
|||||||| ||||||
Sbjct: 217 caaaggttgatcttt 231
Score = 58.0 bits (29), Expect = 2e-08
Identities = 68/81 (83%)
Strand = Plus / Plus
Query: 31 aagaccatcaccttggaggtggagagttcagataccattgataacgcaaaagccaagatc 90
|||||||| || |||||||| ||||||||||| || |||||||| | ||||| |||||
Sbjct: 811 aagaccattactttggaggttgagagttcagacacgattgataatgtcaaagctaagatt 870
Query: 91 caagataaggaagggatccca 111
|| |||||||| || ||||||
Sbjct: 871 caggataaggagggtatccca 891
Score = 56.0 bits (28), Expect = 7e-08
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 31 aagaccatcaccttggaggtggagagttcagataccattgataa 74
|||||||| || ||||| |||||||||||||| |||||||||||
Sbjct: 583 aagaccataacattggaagtggagagttcagacaccattgataa 626
Score = 52.0 bits (26), Expect = 1e-06
Identities = 92/114 (80%)
Strand = Plus / Plus
Query: 22 ttgaccggcaagaccatcaccttggaggtggagagttcagataccattgataacgcaaaa 81
||||| || |||||||| || ||||||| |||||||| ||||| ||||| || | |||
Sbjct: 1030 ttgacggggaagaccataactctggaggttgagagttctgatacaattgacaatgtgaaa 1089
Query: 82 gccaagatccaagataaggaagggatcccagctgatcagcaaaggttcatcttt 135
|| ||||| || ||||||||||| ||||| | |||||||| ||| | ||||||
Sbjct: 1090 gctaagattcaggataaggaaggtatccctccggatcagcagaggcttatcttt 1143
>gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (32%)
Length = 471
Score = 117 bits (59), Expect = 2e-26
Identities = 116/135 (85%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||| || |||||||| | |||||||||||||| ||| | |||||||| ||||||
Sbjct: 101 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 160
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| || | ||||| || |||||||| ||||||||||||||| ||||||||
Sbjct: 161 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 220
Query: 121 caaaggttcatcttt 135
|||||| | ||||||
Sbjct: 221 caaaggcttatcttt 235
>gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (35%)
Length = 523
Score = 117 bits (59), Expect = 2e-26
Identities = 116/135 (85%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||| || |||||||| | |||||||||||||| ||| | |||||||| ||||||
Sbjct: 124 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 183
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| || | ||||| || |||||||| ||||||||||||||| ||||||||
Sbjct: 184 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 243
Query: 121 caaaggttcatcttt 135
|||||| | ||||||
Sbjct: 244 caaaggcttatcttt 258
>gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (56%)
Length = 725
Score = 117 bits (59), Expect = 2e-26
Identities = 116/135 (85%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||| || |||||||| | |||||||||||||| ||| | |||||||| ||||||
Sbjct: 85 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 144
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| || | ||||| || |||||||| ||||||||||||||| ||||||||
Sbjct: 145 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 204
Query: 121 caaaggttcatcttt 135
|||||| | ||||||
Sbjct: 205 caaaggcttatcttt 219
>gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
thaliana (Mouse-ear cress), complete
Length = 1440
Score = 77.8 bits (39), Expect = 2e-14
Identities = 111/135 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||||||||| |||| || ||||| || |||||||| ||| ||||||||||||| ||
Sbjct: 1013 atgcagatctttgtgaagaccttgactggtaagaccattaccctggaggtggagagctcc 1072
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
||||||||||| |||| || || || || ||||| |||||||| |||||| | || |||
Sbjct: 1073 gataccattgacaacgtgaaggcaaaaattcaagacaaggaaggtatcccaccggaccag 1132
Query: 121 caaaggttcatcttt 135
|| ||||| ||||||
Sbjct: 1133 cagaggttgatcttt 1147
Score = 65.9 bits (33), Expect = 7e-11
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||| ||| |||| |||||||| || ||||||||||| | ||||||||||| ||
Sbjct: 785 atgcagattttcgtgaagactttgactggtaagaccatcactcttgaggtggagagctct 844
Query: 61 gataccattgataacgcaaaagccaagatccaagataagga 101
|| |||||||| |||| || || |||||||| ||||||||
Sbjct: 845 gacaccattgacaacgtgaaggctaagatccaggataagga 885
Score = 61.9 bits (31), Expect = 1e-09
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||||||| | || || ||||| ||||||||||||||| | ||||| ||||| ||
Sbjct: 557 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 616
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
|| ||||| || |||| || || ||||||||||| ||||| || ||||| | || |||
Sbjct: 617 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 676
Query: 121 caaaggttcatcttt 135
|| ||||| ||||||
Sbjct: 677 cagaggttgatcttt 691
>gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
hypogaea (Peanut), complete
Length = 664
Score = 67.9 bits (34), Expect = 2e-11
Identities = 49/54 (90%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggag 54
|||||||||||| ||||||| |||||||||||||||||||| | |||||||||
Sbjct: 46 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggag 99
>gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (41%)
Length = 617
Score = 63.9 bits (32), Expect = 3e-10
Identities = 86/104 (82%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||| |||||| ||||||| | ||||| ||||| ||||| | ||||| |||||||||
Sbjct: 85 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 144
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagg 104
||||||||| | |||| ||||| ||||||||||| || |||||
Sbjct: 145 gataccattaacaacgtgaaagctaagatccaagacaaagaagg 188
Score = 56.0 bits (28), Expect = 7e-08
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 31 aagaccatcaccttggaggtggagagttcagataccattgataa 74
|||||||| || ||||| |||||||||||||| |||||||||||
Sbjct: 257 aagaccataacattggaagtggagagttcagacaccattgataa 300
>gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromosome undetermined
scaffold_80, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_80, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (98%)
Length = 879
Score = 63.9 bits (32), Expect = 3e-10
Identities = 104/128 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||||||||| |||| |||||||| || |||||||||||| | ||||| |||||
Sbjct: 167 atgcagatctttgtgaagactttgactggaaagaccatcaccctcgaggttgagagcagc 226
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
|| ||||| || |||| || ||||||||||| || |||||||| ||||| | ||||||
Sbjct: 227 gacaccatcgacaacgtcaaggccaagatccaggacaaggaaggcatccctccggatcag 286
Query: 121 caaaggtt 128
||||||||
Sbjct: 287 caaaggtt 294
>gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (67%)
Length = 881
Score = 61.9 bits (31), Expect = 1e-09
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||||||| | || || ||||| ||||||||||||||| | ||||| ||||| ||
Sbjct: 566 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 625
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
|| ||||| || |||| || || ||||||||||| ||||| || ||||| | || |||
Sbjct: 626 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 685
Query: 121 caaaggttcatcttt 135
|| ||||| ||||||
Sbjct: 686 cagaggttgatcttt 700
Score = 56.0 bits (28), Expect = 7e-08
Identities = 64/76 (84%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||| ||| |||| |||||||| || ||||||||||| | ||||||||||| ||
Sbjct: 794 atgcagattttcgtgaagactttgactggtaagaccatcactcttgaggtggagagctct 853
Query: 61 gataccattgataacg 76
|| |||||||| ||||
Sbjct: 854 gacaccattgacaacg 869
>gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
(Alpine penny-cress) (Thlaspi calaminare), partial (36%)
Length = 487
Score = 60.0 bits (30), Expect = 4e-09
Identities = 90/110 (81%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
|||||||||||| | || || ||||| ||||||||||||||| | ||||| ||||| ||
Sbjct: 298 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 357
Query: 61 gataccattgataacgcaaaagccaagatccaagataaggaagggatccc 110
|| ||||| || |||| || || ||||||||||| ||||| || |||||
Sbjct: 358 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccc 407
>gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
annuus|Rep: Hexaubiquitin protein - Helianthus annuus
(Common sunflower), complete
Length = 1623
Score = 56.0 bits (28), Expect = 7e-08
Identities = 70/84 (83%)
Strand = Plus / Plus
Query: 28 ggcaagaccatcaccttggaggtggagagttcagataccattgataacgcaaaagccaag 87
|||||||||||||| | || || ||||||||||||||||| || || | || || ||
Sbjct: 131 ggcaagaccatcactctcgaagttgagagttcagataccatagacaatgtgaaggctaaa 190
Query: 88 atccaagataaggaagggatccca 111
|| |||||||||||||||||||||
Sbjct: 191 attcaagataaggaagggatccca 214
Score = 54.0 bits (27), Expect = 3e-07
Identities = 60/71 (84%)
Strand = Plus / Plus
Query: 1 atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
||||||||||| |||| || ||||| || |||||||||||| | ||||||||||| ||
Sbjct: 332 atgcagatctttgtgaagacattgactggaaagaccatcacccttgaggtggagagctct 391
Query: 61 gataccattga 71
|| ||||||||
Sbjct: 392 gacaccattga 402