Miyakogusa Predicted Gene

Lj2g3v2197680.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2197680.1 Non Chatacterized Hit- tr|J3N0A4|J3N0A4_ORYBR
Uncharacterized protein OS=Oryza brachyantha
GN=OB09G2,87.04,1e-17,Ubiquitin homologues,Ubiquitin;
UBIQUITIN_2,Ubiquitin supergroup; ubiquitin,Ubiquitin;
Ubiquitin-lik,CUFF.38727.1
         (165 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ...   188   7e-48
gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubi...   157   2e-38
gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ...   157   2e-38
gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ...   157   2e-38
gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension ...   125   9e-29
gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein...   125   9e-29
gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; ...   117   2e-26
gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...   117   2e-26
gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...   117   2e-26
gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; ...    78   2e-14
gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion prot...    68   2e-11
gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiq...    64   3e-10
gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromoso...    64   3e-10
gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...    62   1e-09
gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; T...    60   4e-09
gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein...    56   7e-08

>gnl|LJGI|TC67537 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
           eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
           thaliana (Mouse-ear cress), partial (80%)
          Length = 1160

 Score =  188 bits (95), Expect = 7e-48
 Identities = 125/135 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||||||  |||||||| |||||||||||||||||||||| |||||||||||||||
Sbjct: 86  atgcagatctttgtgaaaactctgaccggcaagaccatcaccttagaggtggagagttca 145

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           |||||||||||||| | ||||||||||||||| |||||||||||||||||| ||||||||
Sbjct: 146 gataccattgataatgtaaaagccaagatccaggataaggaagggatcccacctgatcag 205

                          
Query: 121 caaaggttcatcttt 135
           |||||| | ||||||
Sbjct: 206 caaaggcttatcttt 220



 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 92/114 (80%)
 Strand = Plus / Plus

                                                                       
Query: 22  ttgaccggcaagaccatcaccttggaggtggagagttcagataccattgataacgcaaaa 81
           ||||| || ||||| || || ||||||||||| || |||||||| |||||||| |  |||
Sbjct: 563 ttgacaggaaagacaataacgttggaggtggaaagctcagatactattgataatgtgaaa 622

                                                                 
Query: 82  gccaagatccaagataaggaagggatcccagctgatcagcaaaggttcatcttt 135
           |||||||| || || ||||| || |||||  | || ||||| ||| ||||||||
Sbjct: 623 gccaagattcaggacaaggagggcatcccgccagaccagcagaggctcatcttt 676


>gnl|LJGI|BW626875 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (31%)
          Length = 486

 Score =  157 bits (79), Expect = 2e-38
 Identities = 121/135 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           ||||| |||||| ||||||| ||||| ||||||||||||||| | |||||||||||||||
Sbjct: 128 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 187

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| || |  ||||||||||||||||| ||||||||||||||| ||||||||
Sbjct: 188 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 247

                          
Query: 121 caaaggttcatcttt 135
           |||||| | ||||||
Sbjct: 248 caaaggcttatcttt 262


>gnl|LJGI|BW623815 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (33%)
          Length = 510

 Score =  157 bits (79), Expect = 2e-38
 Identities = 121/135 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           ||||| |||||| ||||||| ||||| ||||||||||||||| | |||||||||||||||
Sbjct: 133 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 192

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| || |  ||||||||||||||||| ||||||||||||||| ||||||||
Sbjct: 193 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 252

                          
Query: 121 caaaggttcatcttt 135
           |||||| | ||||||
Sbjct: 253 caaaggcttatcttt 267


>gnl|LJGI|TC77422 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
           eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
           thaliana (Mouse-ear cress), complete
          Length = 1468

 Score =  157 bits (79), Expect = 2e-38
 Identities = 121/135 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           ||||| |||||| ||||||| ||||| ||||||||||||||| | |||||||||||||||
Sbjct: 104 atgcaaatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggtggagagttca 163

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| || |  ||||||||||||||||| ||||||||||||||| ||||||||
Sbjct: 164 gataccattgacaatgttaaagccaagatccaagacaaggaagggatcccacctgatcag 223

                          
Query: 121 caaaggttcatcttt 135
           |||||| | ||||||
Sbjct: 224 caaaggcttatcttt 238



 Score = 73.8 bits (37), Expect = 3e-13
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 22  ttgaccggcaagaccatcaccttggaggtggagagttcagataccattgataa 74
           ||||| || ||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 581 ttgacagggaagaccatcactttggaggtggagagttctgataccattgataa 633


>gnl|LJGI|AV407232 UniRef100_A0MKC8 Cluster: Ubiquitin extension protein; n=2; core
           eudicotyledons|Rep: Ubiquitin extension protein -
           Capsicum annuum (Bell pepper), partial (42%)
          Length = 361

 Score =  125 bits (63), Expect = 9e-29
 Identities = 117/135 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           ||||| |||||| |||||||  | ||||| ||||| |||||  | ||||| |||||||||
Sbjct: 135 atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 194

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| ||||  ||||| ||||||||||| ||||||||||||||| ||||||||
Sbjct: 195 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 254

                          
Query: 121 caaaggttcatcttt 135
           |||||||| ||||||
Sbjct: 255 caaaggttgatcttt 269


>gnl|LJGI|TC78962 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
           annuus|Rep: Hexaubiquitin protein - Helianthus annuus
           (Common sunflower), complete
          Length = 1704

 Score =  125 bits (63), Expect = 9e-29
 Identities = 117/135 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           ||||| |||||| |||||||  | ||||| ||||| |||||  | ||||| |||||||||
Sbjct: 97  atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 156

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| ||||  ||||| ||||||||||| ||||||||||||||| ||||||||
Sbjct: 157 gataccattgacaacgtgaaagctaagatccaagacaaggaagggatcccacctgatcag 216

                          
Query: 121 caaaggttcatcttt 135
           |||||||| ||||||
Sbjct: 217 caaaggttgatcttt 231



 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 31  aagaccatcaccttggaggtggagagttcagataccattgataacgcaaaagccaagatc 90
           |||||||| || |||||||| ||||||||||| || |||||||| |  ||||| ||||| 
Sbjct: 811 aagaccattactttggaggttgagagttcagacacgattgataatgtcaaagctaagatt 870

                                
Query: 91  caagataaggaagggatccca 111
           || |||||||| || ||||||
Sbjct: 871 caggataaggagggtatccca 891



 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 31  aagaccatcaccttggaggtggagagttcagataccattgataa 74
           |||||||| || ||||| |||||||||||||| |||||||||||
Sbjct: 583 aagaccataacattggaagtggagagttcagacaccattgataa 626



 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 92/114 (80%)
 Strand = Plus / Plus

                                                                        
Query: 22   ttgaccggcaagaccatcaccttggaggtggagagttcagataccattgataacgcaaaa 81
            ||||| || |||||||| ||  ||||||| |||||||| ||||| ||||| || |  |||
Sbjct: 1030 ttgacggggaagaccataactctggaggttgagagttctgatacaattgacaatgtgaaa 1089

                                                                  
Query: 82   gccaagatccaagataaggaagggatcccagctgatcagcaaaggttcatcttt 135
            || ||||| || ||||||||||| |||||  | |||||||| ||| | ||||||
Sbjct: 1090 gctaagattcaggataaggaaggtatccctccggatcagcagaggcttatcttt 1143


>gnl|LJGI|BW623042 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (32%)
          Length = 471

 Score =  117 bits (59), Expect = 2e-26
 Identities = 116/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||| ||  |||||||| | |||||||||||||| ||| | |||||||| ||||||
Sbjct: 101 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 160

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| || |  ||||| || |||||||| ||||||||||||||| ||||||||
Sbjct: 161 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 220

                          
Query: 121 caaaggttcatcttt 135
           |||||| | ||||||
Sbjct: 221 caaaggcttatcttt 235


>gnl|LJGI|TC80080 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (35%)
          Length = 523

 Score =  117 bits (59), Expect = 2e-26
 Identities = 116/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||| ||  |||||||| | |||||||||||||| ||| | |||||||| ||||||
Sbjct: 124 atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 183

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| || |  ||||| || |||||||| ||||||||||||||| ||||||||
Sbjct: 184 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 243

                          
Query: 121 caaaggttcatcttt 135
           |||||| | ||||||
Sbjct: 244 caaaggcttatcttt 258


>gnl|LJGI|TC71652 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (56%)
          Length = 725

 Score =  117 bits (59), Expect = 2e-26
 Identities = 116/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||| ||  |||||||| | |||||||||||||| ||| | |||||||| ||||||
Sbjct: 85  atgcagatttttgtgaaaactctcaccggcaagaccattacccttgaggtggaaagttca 144

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           ||||||||||| || |  ||||| || |||||||| ||||||||||||||| ||||||||
Sbjct: 145 gataccattgacaatgttaaagcgaaaatccaagacaaggaagggatcccacctgatcag 204

                          
Query: 121 caaaggttcatcttt 135
           |||||| | ||||||
Sbjct: 205 caaaggcttatcttt 219


>gnl|LJGI|TC79728 UniRef100_Q7EUR6 Cluster: AT4g05320/C17L7_240; n=8; core
            eudicotyledons|Rep: AT4g05320/C17L7_240 - Arabidopsis
            thaliana (Mouse-ear cress), complete
          Length = 1440

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 111/135 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
            |||||||||||  |||| || ||||| || |||||||| ||| ||||||||||||| || 
Sbjct: 1013 atgcagatctttgtgaagaccttgactggtaagaccattaccctggaggtggagagctcc 1072

                                                                        
Query: 61   gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
            ||||||||||| ||||  || || || || ||||| |||||||| |||||| | || |||
Sbjct: 1073 gataccattgacaacgtgaaggcaaaaattcaagacaaggaaggtatcccaccggaccag 1132

                           
Query: 121  caaaggttcatcttt 135
            || ||||| ||||||
Sbjct: 1133 cagaggttgatcttt 1147



 Score = 65.9 bits (33), Expect = 7e-11
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||| ||| |||| |||||||| || |||||||||||  | ||||||||||| || 
Sbjct: 785 atgcagattttcgtgaagactttgactggtaagaccatcactcttgaggtggagagctct 844

                                                    
Query: 61  gataccattgataacgcaaaagccaagatccaagataagga 101
           || |||||||| ||||  || || |||||||| ||||||||
Sbjct: 845 gacaccattgacaacgtgaaggctaagatccaggataagga 885



 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 109/135 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||||||| | || || ||||| ||||||||||||||| | ||||| ||||| || 
Sbjct: 557 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 616

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           || ||||| || ||||  || || ||||||||||| ||||| || |||||  | || |||
Sbjct: 617 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 676

                          
Query: 121 caaaggttcatcttt 135
           || ||||| ||||||
Sbjct: 677 cagaggttgatcttt 691


>gnl|LJGI|TC64454 UniRef100_Q45W78 Cluster: Ubiquitin fusion protein; n=3; core
          eudicotyledons|Rep: Ubiquitin fusion protein - Arachis
          hypogaea (Peanut), complete
          Length = 664

 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                
Query: 1  atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggag 54
          |||||||||||| |||||||  |||||||||||||||||||| | |||||||||
Sbjct: 46 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctcgaggtggag 99


>gnl|LJGI|TC81522 homologue to UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (41%)
          Length = 617

 Score = 63.9 bits (32), Expect = 3e-10
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           ||||| |||||| |||||||  | ||||| ||||| |||||  | ||||| |||||||||
Sbjct: 85  atgcaaatcttcgtgaaaaccctaaccgggaagacaatcactctcgaggtagagagttca 144

                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagg 104
           ||||||||| | ||||  ||||| ||||||||||| || |||||
Sbjct: 145 gataccattaacaacgtgaaagctaagatccaagacaaagaagg 188



 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 31  aagaccatcaccttggaggtggagagttcagataccattgataa 74
           |||||||| || ||||| |||||||||||||| |||||||||||
Sbjct: 257 aagaccataacattggaagtggagagttcagacaccattgataa 300


>gnl|LJGI|TC76922 homologue to UniRef100_A7QD64 Cluster: Chromosome undetermined
           scaffold_80, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_80, whole
           genome shotgun sequence - Vitis vinifera (Grape),
           partial (98%)
          Length = 879

 Score = 63.9 bits (32), Expect = 3e-10
 Identities = 104/128 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||||||  |||| |||||||| || |||||||||||| | ||||| |||||    
Sbjct: 167 atgcagatctttgtgaagactttgactggaaagaccatcaccctcgaggttgagagcagc 226

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           || ||||| || ||||  || ||||||||||| || |||||||| |||||  | ||||||
Sbjct: 227 gacaccatcgacaacgtcaaggccaagatccaggacaaggaaggcatccctccggatcag 286

                   
Query: 121 caaaggtt 128
           ||||||||
Sbjct: 287 caaaggtt 294


>gnl|LJGI|TC81113 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (67%)
          Length = 881

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 109/135 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||||||| | || || ||||| ||||||||||||||| | ||||| ||||| || 
Sbjct: 566 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 625

                                                                       
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatcccagctgatcag 120
           || ||||| || ||||  || || ||||||||||| ||||| || |||||  | || |||
Sbjct: 626 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 685

                          
Query: 121 caaaggttcatcttt 135
           || ||||| ||||||
Sbjct: 686 cagaggttgatcttt 700



 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||| ||| |||| |||||||| || |||||||||||  | ||||||||||| || 
Sbjct: 794 atgcagattttcgtgaagactttgactggtaagaccatcactcttgaggtggagagctct 853

                           
Query: 61  gataccattgataacg 76
           || |||||||| ||||
Sbjct: 854 gacaccattgacaacg 869


>gnl|LJGI|TC79910 UniRef100_A1X1E5 Cluster: Polyubiquitin; n=1; Thlaspi
           caerulescens|Rep: Polyubiquitin - Thlaspi caerulescens
           (Alpine penny-cress) (Thlaspi calaminare), partial (36%)
          Length = 487

 Score = 60.0 bits (30), Expect = 4e-09
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||||||| | || || ||||| ||||||||||||||| | ||||| ||||| || 
Sbjct: 298 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 357

                                                             
Query: 61  gataccattgataacgcaaaagccaagatccaagataaggaagggatccc 110
           || ||||| || ||||  || || ||||||||||| ||||| || |||||
Sbjct: 358 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccc 407


>gnl|LJGI|TC60580 UniRef100_Q42397 Cluster: Hexaubiquitin protein; n=1; Helianthus
           annuus|Rep: Hexaubiquitin protein - Helianthus annuus
           (Common sunflower), complete
          Length = 1623

 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ggcaagaccatcaccttggaggtggagagttcagataccattgataacgcaaaagccaag 87
           ||||||||||||||  | || || ||||||||||||||||| || || |  || || || 
Sbjct: 131 ggcaagaccatcactctcgaagttgagagttcagataccatagacaatgtgaaggctaaa 190

                                   
Query: 88  atccaagataaggaagggatccca 111
           || |||||||||||||||||||||
Sbjct: 191 attcaagataaggaagggatccca 214



 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagatcttcatgaaaactttgaccggcaagaccatcaccttggaggtggagagttca 60
           |||||||||||  |||| || ||||| || |||||||||||| | ||||||||||| || 
Sbjct: 332 atgcagatctttgtgaagacattgactggaaagaccatcacccttgaggtggagagctct 391

                      
Query: 61  gataccattga 71
           || ||||||||
Sbjct: 392 gacaccattga 402