Miyakogusa Predicted Gene
- Lj2g3v0077680.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0077680.1 gene.g38371.t1.1
(1089 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72631 weakly similar to UniRef100_Q1SKZ9 Cluster: Zin... 58 1e-07
>gnl|LJGI|TC72631 weakly similar to UniRef100_Q1SKZ9 Cluster: Zinc finger, CCHC-type;
n=1; Medicago truncatula|Rep: Zinc finger, CCHC-type -
Medicago truncatula (Barrel medic), partial (15%)
Length = 902
Score = 58.0 bits (29), Expect = 1e-07
Identities = 133/165 (80%), Gaps = 2/165 (1%)
Strand = Plus / Plus
Query: 346 gtttggattcgcattccaggtcttggcttccaattctatggcaagaatattctcatgacg 405
|||||||| || |||||||| || || ||||||||||| |||||| || || | |||
Sbjct: 242 gtttggatccgtattccagggctaggattccaattctacaacaagaacatcctgctcacg 301
Query: 406 ttggcgtcagcggtgggaacacccatcaaagtggatttgaacacaacat-atatgcatag 464
| || ||||||||||| || || ||||| ||||| ||||| || ||| ||||||| |
Sbjct: 302 ctagcctcagcggtgggtactcctatcaaggtggacttgaatacg-catgatatgcagcg 360
Query: 465 aggcaagtttgcacgtatatgtgtagagattgatcttaacaaacc 509
||||||| ||||||||||||||| ||||||||||| | ||||||
Sbjct: 361 gggcaagtatgcacgtatatgtgtggagattgatctcaccaaacc 405