Miyakogusa Predicted Gene
- Lj1g3v4691670.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4691670.2 tr|G7J219|G7J219_MEDTR Replication protein A 70
kDa DNA-binding subunit OS=Medicago truncatula
GN=MT,46.32,5e-18,DUF223,Domain of unknown function DUF223; seg,NULL;
Nucleic acid-binding proteins,Nucleic acid-bindi,CUFF.32881.2
(291 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO036590 weakly similar to UniRef100_Q2HSY3 Cluster: Nu... 561 e-160
>gnl|LJGI|GO036590 weakly similar to UniRef100_Q2HSY3 Cluster: Nucleic acid-binding,
OB-fold, subgroup; n=1; Medicago truncatula|Rep: Nucleic
acid-binding, OB-fold, subgroup - Medicago truncatula
(Barrel medic), partial (23%)
Length = 637
Score = 561 bits (283), Expect = e-160
Identities = 289/291 (99%)
Strand = Plus / Plus
Query: 1 atggcaatcaaagttgatgatgtctcagatgtgaataattcaaaggatacttggaacatc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 atggcaatcaaagttgatgatgtctcagatgtgaataattcaaaggatacttggaacatc 234
Query: 61 gttacaaaggtggttcgtttgtgggttagtcccagcttcagtggagggaaattgccattc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 235 gttacaaaggtggttcgtttgtgggttagtcccagcttcagtggagggaaattgccattc 294
Query: 121 tcaatggagttggtgttgatggattcaaagggttgtcagattcatgcttcagtgaggaaa 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 295 tcaatggagttggtgttgatggattcaaagggttgtcagattcatgcttcagtgaggaaa 354
Query: 181 actttggtctataggttccaccccctgttgactgaaggtcaggtctatcagatttcatat 240
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 355 actttggtctataggttccaccccctgttgactgaaggtcgggtctatcagatttcatat 414
Query: 241 tttggtgttggggacaatcttggtgattttagaacaactactcattagttt 291
||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 415 tttggtgttggggacaatcttggtgattttagaacaactactcatcagttt 465