Miyakogusa Predicted Gene

Lj1g3v4691670.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4691670.2 tr|G7J219|G7J219_MEDTR Replication protein A 70
kDa DNA-binding subunit OS=Medicago truncatula
GN=MT,46.32,5e-18,DUF223,Domain of unknown function DUF223; seg,NULL;
Nucleic acid-binding proteins,Nucleic acid-bindi,CUFF.32881.2
         (291 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO036590 weakly similar to UniRef100_Q2HSY3 Cluster: Nu...   561   e-160

>gnl|LJGI|GO036590 weakly similar to UniRef100_Q2HSY3 Cluster: Nucleic acid-binding,
           OB-fold, subgroup; n=1; Medicago truncatula|Rep: Nucleic
           acid-binding, OB-fold, subgroup - Medicago truncatula
           (Barrel medic), partial (23%)
          Length = 637

 Score =  561 bits (283), Expect = e-160
 Identities = 289/291 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcaatcaaagttgatgatgtctcagatgtgaataattcaaaggatacttggaacatc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 atggcaatcaaagttgatgatgtctcagatgtgaataattcaaaggatacttggaacatc 234

                                                                       
Query: 61  gttacaaaggtggttcgtttgtgggttagtcccagcttcagtggagggaaattgccattc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 235 gttacaaaggtggttcgtttgtgggttagtcccagcttcagtggagggaaattgccattc 294

                                                                       
Query: 121 tcaatggagttggtgttgatggattcaaagggttgtcagattcatgcttcagtgaggaaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 295 tcaatggagttggtgttgatggattcaaagggttgtcagattcatgcttcagtgaggaaa 354

                                                                       
Query: 181 actttggtctataggttccaccccctgttgactgaaggtcaggtctatcagatttcatat 240
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 355 actttggtctataggttccaccccctgttgactgaaggtcgggtctatcagatttcatat 414

                                                              
Query: 241 tttggtgttggggacaatcttggtgattttagaacaactactcattagttt 291
           ||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 415 tttggtgttggggacaatcttggtgattttagaacaactactcatcagttt 465