Miyakogusa Predicted Gene

Lj1g3v2809520.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2809520.2 Non Chatacterized Hit- tr|I1MRR1|I1MRR1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.34618
PE,95.54,0,Serine/Threonine protein kinases,
catalytic,Serine/threonine- / dual-specificity protein kinase,
cat,CUFF.29545.2
         (486 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012984 similar to UniRef100_A2Q2V9 Cluster: Protein k...   139   2e-32
gnl|LJGI|TC61380 similar to UniRef100_Q93XL9 Cluster: CTR1-like ...    66   2e-10
gnl|LJGI|TC75998 similar to UniRef100_Q1SMZ9 Cluster: Protein ki...    62   3e-09
gnl|LJGI|GO019680                                                      58   5e-08
gnl|LJGI|TC79856 similar to UniRef100_Q93XL9 Cluster: CTR1-like ...    58   5e-08
gnl|LJGI|TC63662 similar to UniRef100_O23719 Cluster: MAP3K delt...    52   3e-06

>gnl|LJGI|GO012984 similar to UniRef100_A2Q2V9 Cluster: Protein kinase; n=1; Medicago
           truncatula|Rep: Protein kinase - Medicago truncatula
           (Barrel medic), partial (40%)
          Length = 632

 Score =  139 bits (70), Expect = 2e-32
 Identities = 112/126 (88%)
 Strand = Plus / Plus

                                                                       
Query: 347 ggatggcaccagaagttcttcgaaatgaaccatcagatgagaagtcggatgtatacagct 406
           ||||||| || ||||||||||| || ||||| || ||||||||||| || || |||||||
Sbjct: 1   ggatggcgcctgaagttcttcgtaacgaaccctctgatgagaagtctgacgtttacagct 60

                                                                       
Query: 407 ttggggtgatattatgggaacttgcgacagaaaagatcccttgggagaatctcaactcaa 466
           ||||||||||||| |||||||||||||| ||||||||||||||||| | ||||||| |||
Sbjct: 61  ttggggtgatattgtgggaacttgcgactgaaaagatcccttgggatactctcaacacaa 120

                 
Query: 467 tgcagg 472
           ||||||
Sbjct: 121 tgcagg 126


>gnl|LJGI|TC61380 similar to UniRef100_Q93XL9 Cluster: CTR1-like protein kinase; n=2;
           Rosa hybrid cultivar|Rep: CTR1-like protein kinase -
           Rosa hybrid cultivar, partial (14%)
          Length = 1189

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 346 tggatggcaccagaagttcttcgaaatgaaccatcagatgagaagtcggatgtatacagc 405
           |||||||| ||||||||||||||  |||| |||||  |||||||||| ||||| ||||||
Sbjct: 38  tggatggctccagaagttcttcgtgatgagccatcgaatgagaagtctgatgtttacagc 97

                
Query: 406 tttgg 410
           |||||
Sbjct: 98  tttgg 102


>gnl|LJGI|TC75998 similar to UniRef100_Q1SMZ9 Cluster: Protein kinase; n=1; Medicago
           truncatula|Rep: Protein kinase - Medicago truncatula
           (Barrel medic), partial (11%)
          Length = 686

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 346 tggatggcaccagaagttcttcgaaatgaaccatcagatgagaagtcggatgtatacagc 405
           |||||||| ||||||||  | ||||||||||  |||||||| ||||  ||||| || |||
Sbjct: 26  tggatggctccagaagtgttgcgaaatgaactttcagatgaaaagtgtgatgtttatagc 85

                                  
Query: 406 tttggggtgatattatgggaact 428
           | |||||| ||||||||||||||
Sbjct: 86  tatggggtcatattatgggaact 108


>gnl|LJGI|GO019680 
          Length = 580

 Score = 58.0 bits (29), Expect = 5e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 244 ctagttgataagaattggacagtgaaggttggtgattttgg 284
           |||||||| || |||||||||||||||||| ||||||||||
Sbjct: 481 ctagttgacaaaaattggacagtgaaggtttgtgattttgg 521


>gnl|LJGI|TC79856 similar to UniRef100_Q93XL9 Cluster: CTR1-like protein kinase; n=2;
           Rosa hybrid cultivar|Rep: CTR1-like protein kinase -
           Rosa hybrid cultivar, partial (12%)
          Length = 588

 Score = 58.0 bits (29), Expect = 5e-08
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 347 ggatggcaccagaagttcttcgaaatgaaccatcagatgagaagtcggatgtatacagct 406
           ||||||| |||||| |||||||  |||| |||||  |||||||||| ||||| |||||||
Sbjct: 1   ggatggctccagaacttcttcgcgatgagccatcccatgagaagtcagatgtctacagct 60

                                        
Query: 407 ttggggtgatattatgggaacttgcgaca 435
           |||| || || || |||||  ||||||||
Sbjct: 61  ttggcgttatcttttgggagattgcgaca 89


>gnl|LJGI|TC63662 similar to UniRef100_O23719 Cluster: MAP3K delta-1 protein kinase;
           n=1; Arabidopsis thaliana|Rep: MAP3K delta-1 protein
           kinase - Arabidopsis thaliana (Mouse-ear cress), partial
           (66%)
          Length = 1516

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 221 gagatttgaagtcttcaaatcttctagttgataagaattggacagtgaaggttggtgatt 280
           ||||||| |||||| |||||||||| ||||| ||| |||||   || |||||  ||||||
Sbjct: 626 gagatttaaagtctccaaatcttcttgttgacaagcattgggttgtaaaggtctgtgatt 685

                                 
Query: 281 ttggtctttcacgtctgaagca 302
           ||||||| ||| || |||||||
Sbjct: 686 ttggtctgtcaagtttgaagca 707