Miyakogusa Predicted Gene

Lj1g3v2326710.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v2326710.1 Non Chatacterized Hit- tr|B8CDL0|B8CDL0_THAPS
Putative uncharacterized protein ZFP12 (Fragment) OS=T,38.1,3.8,
,CUFF.28902.1
         (361 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61536 similar to UniRef100_Q6IT13 Cluster: Type three...   331   2e-90
gnl|LJGI|TC81734 weakly similar to UniRef100_P36787 Cluster: Reg...    62   2e-09

>gnl|LJGI|TC61536 similar to UniRef100_Q6IT13 Cluster: Type three secretion apparatus
           protein T; n=1; Edwardsiella ictaluri|Rep: Type three
           secretion apparatus protein T - Edwardsiella ictaluri,
           partial (8%)
          Length = 702

 Score =  331 bits (167), Expect = 2e-90
 Identities = 290/334 (86%), Gaps = 28/334 (8%)
 Strand = Plus / Plus

                                                                       
Query: 54  tctgggtatgagtttcagaggttcagatcgaaccagatcttgttttttctcacagttcaa 113
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 279 tctgggtatgagtttcagaggttcagatcgaaccagatcttattttttctcacagttcaa 338

                                                                       
Query: 114 aaaccccccaaaccccacagtga-ttcatagaaaaagaacacgaaatggcaggaaaaaag 172
           ||| |||| | | |||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 339 aaa-cccctagatcccacagtgatttcatagaaaaagaacacgaaatggcaggaaaaaag 397

                                                                       
Query: 173 gtgaaagcttgaacgcatctgggnnnnnnncttcaatctggggttttcaaggttgttctg 232
           |||||||||||||||||||||||       ||||||||||| ||||||||||||||||||
Sbjct: 398 gtgaaagcttgaacgcatctggg-ttttttcttcaatctggagttttcaaggttgttctg 456

                                                                       
Query: 233 agtgcgaccatggcgtcaagcttctggaaatgttgga------------tatggggtttt 280
           ||||| ||||||||||||||||||||| |||||||||            | |||||||||
Sbjct: 457 agtgcaaccatggcgtcaagcttctgggaatgttggatctggggttgcttctggggtttt 516

                                                                       
Query: 281 caaggttgttctcagtgtgtgggttctttg-------------aaattgaaatgttgttg 327
           ||||||||||||||||| ||||||||||||             ||||| |||||||||||
Sbjct: 517 caaggttgttctcagtgcgtgggttctttgatcatttattgttaaattcaaatgttgttg 576

                                             
Query: 328 cttgctgagatttacatttggttttgtttgtaaa 361
           ||||||||||||||||||||||||||||||||||
Sbjct: 577 cttgctgagatttacatttggttttgtttgtaaa 610


>gnl|LJGI|TC81734 weakly similar to UniRef100_P36787 Cluster: Regulatory protein E2;
           n=1; Human papillomavirus type 25|Rep: Regulatory
           protein E2 - Human papillomavirus type 25, partial (6%)
          Length = 712

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 7   cgccgaggcggagtagcaccggaggattggtccagaggccgtc 49
           |||||||||||||||| || ||||||||||| |||||||||||
Sbjct: 476 cgccgaggcggagtagtactggaggattggtacagaggccgtc 434