Miyakogusa Predicted Gene

Lj0g3v0312829.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0312829.1 tr|G7KTW4|G7KTW4_MEDTR Receptor-like protein
kinase OS=Medicago truncatula GN=MTR_7g021920 PE=4
SV=1,50,1.3,seg,NULL,CUFF.21113.1
         (118 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81116                                                       62   7e-10

>gnl|LJGI|TC81116 
          Length = 592

 Score = 61.9 bits (31), Expect = 7e-10
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 13  gagtgtgagttatgtcaacttgaaaaacatgttagggca 51
           |||||||||| ||||||||||| ||||||||||||||||
Sbjct: 376 gagtgtgagtcatgtcaacttggaaaacatgttagggca 414