Miyakogusa Predicted Gene

Lj0g3v0312269.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0312269.1 Non Chatacterized Hit- tr|I1K660|I1K660_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.58354
PE,69.1,0,seg,NULL; no description,Cytochrome P450; FAMILY NOT
NAMED,NULL; p450,Cytochrome P450; Cytochrome P4,CUFF.21070.1
         (1077 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AW720487 similar to UniRef100_A7Q7B4 Cluster: Chromosom...    54   2e-06
gnl|LJGI|TC61015 similar to UniRef100_Q2MJ20 Cluster: Cytochrome...    54   2e-06

>gnl|LJGI|AW720487 similar to UniRef100_A7Q7B4 Cluster: Chromosome chr18 scaffold_59,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_59, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (29%)
          Length = 575

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 385 aagaagatgagacacatgctgcctcagttcctcaacgcaaaagcacttcaacgttatgtt 444
           |||||||||||| | ||||| |||||||| || ||  || |||| |||||||| || |||
Sbjct: 455 aagaagatgagaaagatgctccctcagtttctgaaaccacaagctcttcaacgctacgtt 514

                      
Query: 445 ggtatcatgga 455
           |||||||||||
Sbjct: 515 ggtatcatgga 525


>gnl|LJGI|TC61015 similar to UniRef100_Q2MJ20 Cluster: Cytochrome P450 monooxygenase
           CYP716A12; n=1; Medicago truncatula|Rep: Cytochrome P450
           monooxygenase CYP716A12 - Medicago truncatula (Barrel
           medic), partial (45%)
          Length = 780

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 385 aagaagatgagacacatgctgcctcagttcctcaacgcaaaagcacttcaacgttatgtt 444
           |||||||||||| | ||||| |||||||| || ||  || |||| |||||||| || |||
Sbjct: 479 aagaagatgagaaagatgctccctcagtttctgaaaccacaagctcttcaacgctacgtt 538

                      
Query: 445 ggtatcatgga 455
           |||||||||||
Sbjct: 539 ggtatcatgga 549