Miyakogusa Predicted Gene

Lj0g3v0268689.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0268689.1 Non Chatacterized Hit- tr|Q9LE84|Q9LE84_ARATH
Putative uncharacterized protein AT4g08820
OS=Arabidop,34.59,1e-18,Ribonuclease H-like,Ribonuclease H-like
domain; seg,NULL; DUF4283,Domain of unknown function
DUF4283,gene.g20838.t1.1
         (1095 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72631 weakly similar to UniRef100_Q1SKZ9 Cluster: Zin...    58   1e-07

>gnl|LJGI|TC72631 weakly similar to UniRef100_Q1SKZ9 Cluster: Zinc finger, CCHC-type;
           n=1; Medicago truncatula|Rep: Zinc finger, CCHC-type -
           Medicago truncatula (Barrel medic), partial (15%)
          Length = 902

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 133/165 (80%), Gaps = 2/165 (1%)
 Strand = Plus / Plus

                                                                       
Query: 352 gtttggattcgcattccaggtcttggcttccaattctatggcaagaatattctcatgacg 411
           |||||||| || |||||||| || || |||||||||||   |||||| || ||  | |||
Sbjct: 242 gtttggatccgtattccagggctaggattccaattctacaacaagaacatcctgctcacg 301

                                                                       
Query: 412 ttggcgtcagcggtgggaacacccatcaaagtggatttgaacacaacat-atatgcatag 470
            | || ||||||||||| || || ||||| ||||| ||||| ||  ||| |||||||  |
Sbjct: 302 ctagcctcagcggtgggtactcctatcaaggtggacttgaatacg-catgatatgcagcg 360

                                                        
Query: 471 aggcaagtttgcacgtatatgtgtagagattgatcttaacaaacc 515
            ||||||| ||||||||||||||| ||||||||||| | ||||||
Sbjct: 361 gggcaagtatgcacgtatatgtgtggagattgatctcaccaaacc 405