Miyakogusa Predicted Gene

Lj0g3v0256499.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0256499.1 Non Chatacterized Hit- tr|C6TKX5|C6TKX5_SOYBN
Putative uncharacterized protein OS=Glycine max PE=4
S,61.46,1e-17,seg,NULL,CUFF.16851.1
         (283 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AW719486 similar to UniRef100_P94024 Cluster: Uncharact...    50   7e-06

>gnl|LJGI|AW719486 similar to UniRef100_P94024 Cluster: Uncharacterized mitochondrial
           protein AtMg00170/AtMg00620; n=3; Arabidopsis
           thaliana|Rep: Uncharacterized mitochondrial protein
           AtMg00170/AtMg00620 - Arabidopsis thaliana (Mouse-ear
           cress), partial (12%)
          Length = 494

 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 224 caccttcagggccttcaaggagacataacaaagtggtggat 264
           |||||||||| ||||||| ||| |||||| |||||||||||
Sbjct: 287 caccttcaggtccttcaaagaggcataacgaagtggtggat 327