Miyakogusa Predicted Gene
- Lj0g3v0245069.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0245069.1 Non Chatacterized Hit- tr|I1LSB4|I1LSB4_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,76.92,0.000000000003,seg,NULL,
NODE_112192_length_325_cov_9.218462.path1.1
(156 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BG662473 202 4e-52
>gnl|LJGI|BG662473
Length = 420
Score = 202 bits (102), Expect = 4e-52
Identities = 105/106 (99%)
Strand = Plus / Plus
Query: 1 atggaagcttttgattgggactgtggcatccttggagatgctcctaagagaatcagtgat 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 atggaagcttttgattgggactgtggcatccttggagatgctcctaagagaatcagtgat 374
Query: 61 ggttttgaagtaaacaatggtgtaaatggaagtgggtatggttcac 106
|||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 375 ggttttgaagtatacaatggtgtaaatggaagtgggtatggttcac 420