Miyakogusa Predicted Gene

Lj0g3v0237409.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0237409.1 Non Chatacterized Hit- tr|I1JGU7|I1JGU7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.24852
PE,74.75,0,seg,NULL; SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
Phi_1,Phosphate-induced protein 1,CUFF.15554.1
         (949 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59790 similar to UniRef100_Q7Y0S8 Cluster: Erg-1; n=1...   168   4e-41
gnl|LJGI|TC75337 similar to UniRef100_Q7Y0S8 Cluster: Erg-1; n=1...   101   8e-21

>gnl|LJGI|TC59790 similar to UniRef100_Q7Y0S8 Cluster: Erg-1; n=1; Solanum
           tuberosum|Rep: Erg-1 - Solanum tuberosum (Potato),
           partial (83%)
          Length = 1251

 Score =  168 bits (85), Expect = 4e-41
 Identities = 205/245 (83%)
 Strand = Plus / Plus

                                                                       
Query: 577 acgcagtgtccgggtcaatgcgcgtggccgtttcataaaccgatttacggaccccaatcg 636
           ||||||||||| || ||||||||||||||||||||  | ||||| || || || ||  ||
Sbjct: 602 acgcagtgtccagggcaatgcgcgtggccgtttcaccagccgatgtatggcccacagacg 661

                                                                       
Query: 637 ccgccgttggtttcgccgaacggcgacattggcgtcgatgggatggtgataaacctggca 696
           |||||||||||  |||||||||| ||  |||| || |||||||||||||| |||||||| 
Sbjct: 662 ccgccgttggtggcgccgaacggtgatgttggtgtggatgggatggtgattaacctggct 721

                                                                       
Query: 697 acggttctggcggggacagttacgaatccgtttgacaatggttattttcaggggccggcg 756
           ||| || |||| || || || |||||||||||| | ||||| || |||||||| ||||| 
Sbjct: 722 acgcttttggctggaactgtgacgaatccgtttaataatggatactttcagggtccggca 781

                                                                       
Query: 757 actgcgccgctggaggcggtgtcggcgtgcaccgggattttcgggaaaggggcgtatccg 816
           || |||||| ||||||||||| |||||||||| ||| |||| ||||  ||||||||||||
Sbjct: 782 acggcgccgttggaggcggtgacggcgtgcactggggtttttgggagcggggcgtatccg 841

                
Query: 817 ggtta 821
           |||||
Sbjct: 842 ggtta 846


>gnl|LJGI|TC75337 similar to UniRef100_Q7Y0S8 Cluster: Erg-1; n=1; Solanum
           tuberosum|Rep: Erg-1 - Solanum tuberosum (Potato),
           partial (73%)
          Length = 1168

 Score =  101 bits (51), Expect = 8e-21
 Identities = 210/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 580 cagtgtccgggtcaatgcgcgtggccgtttcataaaccgatttacggaccccaatcgccg 639
           ||||| ||||| ||||||||||||||||||||| | || |||||||| || ||  |||||
Sbjct: 592 cagtgcccggggcaatgcgcgtggccgtttcatcagcctatttacggcccgcagacgccg 651

                                                                       
Query: 640 ccgttggtttcgccgaacggcgacattggcgtcgatgggatggtgataaacctggcaacg 699
           ||| ||||  |||| ||||||||  | || || || |||||| | || ||| ||||||| 
Sbjct: 652 ccgctggtggcgcccaacggcgatgtcggtgtggacgggatgatcatcaacttggcaacc 711

                                                                       
Query: 700 gttctggcggggacagttacgaatccgtttgacaatggttattttcaggggccggcgact 759
            | || || || || || |||||||||||  | ||||| || |||||||| |||||||| 
Sbjct: 712 ttgcttgctggtaccgtcacgaatccgttcaataatggatactttcagggtccggcgacg 771

                                                                       
Query: 760 gcgccgctggaggcggtgtcggcgtgcaccgggattttcgggaaaggggcgtatccgggt 819
           |||||| |||||||||| || || || || ||  |||||||||  ||| |||||||||||
Sbjct: 772 gcgccgttggaggcggtttcagcttgtactggtgttttcgggagcgggtcgtatccgggt 831

                                  
Query: 820 tacccaggtaacgttctggtgga 842
           ||||| ||| | ||| |||||||
Sbjct: 832 tacccgggtcaggttttggtgga 854