Miyakogusa Predicted Gene

Lj0g3v0200179.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0200179.1 CUFF.12696.1
         (366 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP062487 similar to UniRef100_Q8VZX6 Cluster: Type IIA ...   153   9e-37

>gnl|LJGI|BP062487 similar to UniRef100_Q8VZX6 Cluster: Type IIA calcium ATPase; n=1;
           Medicago truncatula|Rep: Type IIA calcium ATPase -
           Medicago truncatula (Barrel medic), partial (13%)
          Length = 533

 Score =  153 bits (77), Expect = 9e-37
 Identities = 84/85 (98%), Gaps = 1/85 (1%)
 Strand = Plus / Minus

                                                                       
Query: 227 cattagaagaagcagacaaagttgaatcctgtcagcttggaaaccaagcaaaggtatgga 286
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 84  cattagaagaagcagacaaagttgaatcctgtcagcttggaaacc-agcaaaggtatgga 26

                                    
Query: 287 ttggaattttgcagagatgctgtgt 311
           |||||||||||||||||||||||||
Sbjct: 25  ttggaattttgcagagatgctgtgt 1