Miyakogusa Predicted Gene

Lj0g3v0172019.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0172019.1 Non Chatacterized Hit- tr|A5BL14|A5BL14_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,38.5,3e-19,seg,NULL,CUFF.10801.1
         (561 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP048885 homologue to UniRef100_A7PH59 Cluster: Chromos...    54   1e-06

>gnl|LJGI|BP048885 homologue to UniRef100_A7PH59 Cluster: Chromosome chr17
           scaffold_16, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_16, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (7%)
          Length = 523

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 400 tctcaaacccttcaacttttccccttg 426
           |||||||||||||||||||||||||||
Sbjct: 334 tctcaaacccttcaacttttccccttg 308