Miyakogusa Predicted Gene

Lj0g3v0161729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0161729.1 tr|J0WRJ2|J0WRJ2_AURDE Glycosyl hydrolase family
5 protein/cellulase OS=Auricularia delicata
(strain,33.74,2e-19,(Trans)glycosidases,Glycoside hydrolase,
superfamily; no description,Glycoside hydrolase, catalytic
,CUFF.10047.1
         (469 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO025078 similar to UniRef100_Q2HTU0 Cluster: Glycoside...   135   3e-31

>gnl|LJGI|GO025078 similar to UniRef100_Q2HTU0 Cluster: Glycoside hydrolase, family 5;
           Ricin B-related lectin; n=1; Medicago truncatula|Rep:
           Glycoside hydrolase, family 5; Ricin B-related lectin -
           Medicago truncatula (Barrel medic), partial (14%)
          Length = 720

 Score =  135 bits (68), Expect = 3e-31
 Identities = 83/88 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagcttgaggaatgaattgcatggtccacgccaaaatgagaatgattggtacaggtac 60
           |||||||||||||||||||||||||||||||||||||||  |||||||||||||| ||||
Sbjct: 618 atgagcttgaggaatgaattgcatggtccacgccaaaatctgaatgattggtacaagtac 677

                                       
Query: 61  atgagccaaggagcactagccatccata 88
           |||||||||| |||||| ||||||||||
Sbjct: 678 atgagccaagcagcactggccatccata 705