Miyakogusa Predicted Gene
- Lj0g3v0152279.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0152279.1 gene.g11599.t1.1
(453 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC71633 similar to UniRef100_Q6V9R8 Cluster: Anti-Mulle... 78 5e-14
>gnl|LJGI|TC71633 similar to UniRef100_Q6V9R8 Cluster: Anti-Mullerian hormone; n=1;
Macropus eugenii|Rep: Anti-Mullerian hormone - Macropus
eugenii (Tammar wallaby), partial (3%)
Length = 1286
Score = 77.8 bits (39), Expect = 5e-14
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 220 tttgggctaaaacccaatttacccattgatatgagacaacaaggaatcataattcacttc 279
|||||| ||||||||||||||||||| | |||| || ||||||| |||||||||||||
Sbjct: 550 tttgggttaaaacccaatttacccatccacttgaggcagcaaggaaccataattcacttc 491
Query: 280 caagagtcaca 290
|||||||||||
Sbjct: 490 caagagtcaca 480