Miyakogusa Predicted Gene
- Lj0g3v0146999.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0146999.1 CUFF.8981.1
(279 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC68254 similar to UniRef100_Q9FUP6 Cluster: Suspensor-... 545 e-155
gnl|LJGI|TC66238 similar to UniRef100_Q9FUP6 Cluster: Suspensor-... 127 4e-29
gnl|LJGI|TC68603 109 9e-24
gnl|LJGI|TC67770 similar to UniRef100_Q9FUP6 Cluster: Suspensor-... 56 1e-07
>gnl|LJGI|TC68254 similar to UniRef100_Q9FUP6 Cluster: Suspensor-specific protein;
n=1; Phaseolus coccineus|Rep: Suspensor-specific protein
- Phaseolus coccineus (Scarlet runner bean), partial
(28%)
Length = 558
Score = 545 bits (275), Expect = e-155
Identities = 278/279 (99%)
Strand = Plus / Plus
Query: 1 atgaagtccagttttgccgtgttcgcagtcttctctattctcctgattgccaactgtagc 60
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14 atgaagtccatttttgccgtgttcgcagtcttctctattctcctgattgccaactgtagc 73
Query: 61 tgtgcaacaagggacctgggagattattggaagaatatgatgaagggccaagctatgcca 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 74 tgtgcaacaagggacctgggagattattggaagaatatgatgaagggccaagctatgcca 133
Query: 121 gaagcaattaaggaacttgttcaggatccacaagcatcatatgcaggaaaggatcgtttt 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 134 gaagcaattaaggaacttgttcaggatccacaagcatcatatgcaggaaaggatcgtttt 193
Query: 181 atcagggattttgatataaggcctaatgttatattatatcacacccatgttgggtctagt 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 194 atcagggattttgatataaggcctaatgttatattatatcacacccatgttgggtctagt 253
Query: 241 accaagcagaagcagaacacttttgccaaaaactaaaag 279
|||||||||||||||||||||||||||||||||||||||
Sbjct: 254 accaagcagaagcagaacacttttgccaaaaactaaaag 292
>gnl|LJGI|TC66238 similar to UniRef100_Q9FUP6 Cluster: Suspensor-specific protein;
n=1; Phaseolus coccineus|Rep: Suspensor-specific protein
- Phaseolus coccineus (Scarlet runner bean), partial
(67%)
Length = 716
Score = 127 bits (64), Expect = 4e-29
Identities = 143/168 (85%), Gaps = 6/168 (3%)
Strand = Plus / Plus
Query: 77 tgggagattattggaagaatatgatgaagggccaagctatgccagaagcaattaagga-- 134
||||||||||||||||| |||||||||| || ||| ||||||| |||||||| || ||
Sbjct: 132 tgggagattattggaaggatatgatgaatgggcaacctatgcctgaagcaatcaaagacc 191
Query: 135 -acttgttcaggatccacaagcatcatatgc---aggaaaggatcgttttatcagggatt 190
||||||| | |||||||||| |||| |||| ||| ||||||| |||| ||||| |
Sbjct: 192 tacttgttgaagatccacaagtatcagatgctgcagggaaggatcactttactagggact 251
Query: 191 ttgatataaggcctaatgttatattatatcacacccatgttgggtcta 238
||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 252 ttgatataaggcctaatgtcatattatatcacacccatgttgagtcta 299
>gnl|LJGI|TC68603
Length = 548
Score = 109 bits (55), Expect = 9e-24
Identities = 169/207 (81%)
Strand = Plus / Plus
Query: 1 atgaagtccagttttgccgtgttcgcagtcttctctattctcctgattgccaactgtagc 60
|||||||||| | |||| |||| | |||||||||| |||||||||||| ||| |||
Sbjct: 26 atgaagtccatctctgccatgtttgtagtcttctctgttctcctgattgtgaacctcagc 85
Query: 61 tgtgcaacaagggacctgggagattattggaagaatatgatgaagggccaagctatgcca 120
|| || || |||| |||||| |||||||||||| ||||||| ||||| |||||||
Sbjct: 86 catggaagaaaggacatgggaggctattggaagaatgtgatgaatggccagcctatgcct 145
Query: 121 gaagcaattaaggaacttgttcaggatccacaagcatcatatgcaggaaaggatcgtttt 180
|||| |||| || ||| |||| |||||||| |||||| |||||||||| |||| ||||
Sbjct: 146 gaagtggttaaagaccttattcaagatccacatgcatcagatgcaggaaaagatcatttt 205
Query: 181 atcagggattttgatataaggcctaat 207
|||||||| |||||||||| |||||||
Sbjct: 206 atcagggactttgatataaagcctaat 232
>gnl|LJGI|TC67770 similar to UniRef100_Q9FUP6 Cluster: Suspensor-specific protein;
n=1; Phaseolus coccineus|Rep: Suspensor-specific protein
- Phaseolus coccineus (Scarlet runner bean), partial
(53%)
Length = 607
Score = 56.0 bits (28), Expect = 1e-07
Identities = 46/52 (88%)
Strand = Plus / Plus
Query: 80 gagattattggaagaatatgatgaagggccaagctatgccagaagcaattaa 131
|||| |||||||||||| |||||| |||||| ||||||| |||||||||||
Sbjct: 87 gagactattggaagaatgcgatgaatggccaacctatgcctgaagcaattaa 138
Score = 56.0 bits (28), Expect = 1e-07
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 169 aaggatcgttttatcagggattttgatataaggcctaatgttatattatatcacacccat 228
||||||| ||||| ||||| |||||||||| || ||||| |||||||| |||||||||
Sbjct: 176 aaggatcattttactagggactttgatataaaacccaatgtcatattataccacacccat 235
Query: 229 gttg 232
||||
Sbjct: 236 gttg 239