Miyakogusa Predicted Gene

Lj0g3v0075849.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0075849.1 tr|G7KK73|G7KK73_MEDTR NBS-LRR resistance protein
OS=Medicago truncatula GN=MTR_6g046130 PE=4 SV=1,27.78,0.0001,L
domain-like,NULL; SUBFAMILY NOT NAMED,NULL; LEUCINE-RICH
REPEAT-CONTAINING PROTEIN,NULL; no descri,CUFF.3824.1
         (1580 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC594028 weakly similar to UniRef100_Q6TAF9 Cluster: Bl...    84   3e-15
gnl|LJGI|DC600163                                                      80   5e-14
gnl|LJGI|BW594902 weakly similar to UniRef100_Q6TAF9 Cluster: Bl...    66   7e-10
gnl|LJGI|GO023675 weakly similar to UniRef100_A7PWE7 Cluster: Ch...    64   3e-09
gnl|LJGI|TC80473                                                       62   1e-08
gnl|LJGI|GO006890 weakly similar to UniRef100_A9TYL7 Cluster: Pr...    58   2e-07
gnl|LJGI|BW596783 weakly similar to UniRef100_Q6YDF1 Cluster: Re...    58   2e-07
gnl|LJGI|TC68797 weakly similar to UniRef100_Q5JLD4 Cluster: NBS...    58   2e-07

>gnl|LJGI|DC594028 weakly similar to UniRef100_Q6TAF9 Cluster: Blight resistance protein
            SH10; n=1; Solanum tuberosum|Rep: Blight resistance
            protein SH10 - Solanum tuberosum (Potato), partial (8%)
          Length = 597

 Score = 83.8 bits (42), Expect = 3e-15
 Identities = 109/130 (83%), Gaps = 1/130 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1425 attgacggaattaccagatgaattcttcaata-cctcaatactttggagcatctggaaat 1483
            ||||| |||||||||| ||||| ||||||| | |||||| | ||||||||||||||||||
Sbjct: 181  attgaaggaattaccaaatgaaatcttcaaaagcctcaacaatttggagcatctggaaat 240

                                                                        
Query: 1484 cagtagttgttttgagttggagtgtttaccggaacaaggctgggaaggtcttcactccct 1543
            |  || ||||    || |||||| |||||| || ||||| ||||||||||| | ||||||
Sbjct: 241  cgttaattgtaggaagctggagtctttaccagagcaagggtgggaaggtctccgctccct 300

                      
Query: 1544 tcgaactctg 1553
            ||||||||||
Sbjct: 301  tcgaactctg 310


>gnl|LJGI|DC600163 
          Length = 535

 Score = 79.8 bits (40), Expect = 5e-14
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 915 ctatgcaggattaaaatccccaagttggattggaatgctcagcagtttagttgatcttca 974
           |||||||||||||||||||||||| ||||||||| ||||||||| |||||| || ||| |
Sbjct: 10  ctatgcaggattaaaatccccaagctggattggattgctcagcaatttagtggagcttga 69

               
Query: 975 actt 978
           ||||
Sbjct: 70  actt 73



 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 70/82 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1076 atgatgatgaatgtaacgatggtgtggaggggagagctttcccatctttggaggaactct 1135
            |||||||||||| | ||||||||||||| | |||||||||||| ||||| || |||||| 
Sbjct: 171  atgatgatgaatcttacgatggtgtggaagtgagagctttcccgtctttagaagaactca 230

                                  
Query: 1136 cattagatgagttgccaaagtt 1157
             |||| || | |||||||||||
Sbjct: 231  aattacattacttgccaaagtt 252


>gnl|LJGI|BW594902 weakly similar to UniRef100_Q6TAF9 Cluster: Blight resistance protein
            SH10; n=1; Solanum tuberosum|Rep: Blight resistance
            protein SH10 - Solanum tuberosum (Potato), partial (4%)
          Length = 487

 Score = 65.9 bits (33), Expect = 7e-10
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 1501 tggagtgtttaccggaacaaggctgggaaggtcttcactcccttcgaactctg 1553
            |||||| |||||| || ||||| ||||||||||||| ||||||||||||||||
Sbjct: 424  tggagtctttaccagagcaagggtgggaaggtcttcgctcccttcgaactctg 476


>gnl|LJGI|GO023675 weakly similar to UniRef100_A7PWE7 Cluster: Chromosome chr8
            scaffold_34, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr8 scaffold_34, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (4%)
          Length = 791

 Score = 63.9 bits (32), Expect = 3e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                    
Query: 1501 tggagtgtttaccggaacaaggctgggaaggtcttcactcccttcgaactctggag 1556
            |||||| |||||| || ||||| ||||||||||| | |||||||||||||||||||
Sbjct: 261  tggagtctttaccagagcaagggtgggaaggtctccgctcccttcgaactctggag 316


>gnl|LJGI|TC80473 
          Length = 741

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1501 tggagtgtttaccggaacaaggctgggaaggtcttcactcccttcgaactctggagttt 1559
            |||||| |||||| || ||||| ||||||||||| | ||||||||||||||||| ||||
Sbjct: 144  tggagtctttaccagagcaagggtgggaaggtctccgctcccttcgaactctggggttt 202



 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1501 tggagtgtttaccggaacaaggctgggaaggtcttcactcccttcgaactctggagttt 1559
            |||||| |||||| || ||||| ||||||||||| | ||||||||||||||||| ||||
Sbjct: 291  tggagtctttaccagagcaagggtgggaaggtctccgctcccttcgaactctggggttt 349



 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 1501 tggagtgtttaccggaacaaggctgggaaggtcttcactcccttcgaactctg 1553
            |||||| |||||| || ||||| ||||||||||| | ||||||||||||||||
Sbjct: 438  tggagtctttaccagagcaagggtgggaaggtctccgctcccttcgaactctg 490


>gnl|LJGI|GO006890 weakly similar to UniRef100_A9TYL7 Cluster: Predicted protein; n=1;
            Physcomitrella patens subsp. patens|Rep: Predicted
            protein - Physcomitrella patens subsp. patens, partial
            (7%)
          Length = 637

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 108/133 (81%), Gaps = 1/133 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1425 attgacggaattaccagatgaattcttcaata-cctcaatactttggagcatctggaaat 1483
            ||||| |||||||||| ||||| ||||||| | |||||| |||||||||||||||  |||
Sbjct: 409  attgaaggaattaccaaatgaactcttcaaaaacctcaacactttggagcatctgataat 468

                                                                        
Query: 1484 cagtagttgttttgagttggagtgtttaccggaacaaggctgggaaggtcttcactccct 1543
            |  |   |||   || ||||||| |||||| ||  |||| |||||||| || ||||||||
Sbjct: 469  ccttttgtgtgaagatttggagtctttaccagagaaaggttgggaaggcctccactccct 528

                         
Query: 1544 tcgaactctggag 1556
            ||||||| |||||
Sbjct: 529  tcgaactgtggag 541


>gnl|LJGI|BW596783 weakly similar to UniRef100_Q6YDF1 Cluster: Resistance protein;
           n=1; Arachis cardenasii|Rep: Resistance protein -
           Arachis cardenasii, partial (31%)
          Length = 482

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 73/85 (85%), Gaps = 2/85 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggtttatctcatcaagggaaaacatggaagcagaagatgttggta-tatgatt-gga 58
           ||||||||||  |||| ||||||||| |||| |  |||||||| || | ||||||| |||
Sbjct: 328 atgggtttattgcatccagggaaaacttggaggttgaagatgtcggcaatatgatttgga 387

                                    
Query: 59  atgaattgtaccaaaaatcattctt 83
           |||||||||| ||||||||||||||
Sbjct: 388 atgaattgtatcaaaaatcattctt 412


>gnl|LJGI|TC68797 weakly similar to UniRef100_Q5JLD4 Cluster: NBS-LRR disease
            resistance protein-like; n=1; Oryza sativa Japonica
            Group|Rep: NBS-LRR disease resistance protein-like -
            Oryza sativa subsp. japonica (Rice), partial (11%)
          Length = 941

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 109/133 (81%), Gaps = 2/133 (1%)
 Strand = Plus / Plus

                                                                        
Query: 1425 attgacggaattaccagatgaattcttcaata-cctcaatactttggagcatctggaaat 1483
            ||||| |||||||||| ||||| ||||||| | |||||| |||||||||||||||  |||
Sbjct: 47   attgaaggaattaccaaatgaactcttcaaaaacctcaacactttggagcatctgataat 106

                                                                        
Query: 1484 cagtagttgttttgagttggagtgtttaccggaacaaggctgggaaggtcttcactccct 1543
            |  | | |||   || ||||||| |||||| ||  |||| |||||||| || ||||||||
Sbjct: 107  cttttg-tgtgaagatttggagtctttaccagagaaaggttgggaaggcctccactccct 165

                         
Query: 1544 tcgaactctggag 1556
            ||||||| |||||
Sbjct: 166  tcgaactgtggag 178