Miyakogusa Predicted Gene

Lj0g3v0064009.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0064009.1 Non Chatacterized Hit- tr|I1LUI3|I1LUI3_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,41.54,0.0003,RALF,Rapid ALkalinization
Factor,gene.Ljchr0_pseudomol_20120828.path1.gene5738.1
         (219 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74539                                                      167   3e-41

>gnl|LJGI|TC74539 
          Length = 606

 Score =  167 bits (84), Expect = 3e-41
 Identities = 179/210 (85%), Gaps = 3/210 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgttggttgtcttcctcagtgctcttttggtttgcatgcttttcacccaggatgctaat 60
           ||||||||| ||||| | ||||||||||||||||||   ||||||||||| |||||| ||
Sbjct: 68  atgttggttctcttcgttagtgctcttttggtttgcgcacttttcacccaagatgctgat 127

                                                                       
Query: 61  gctaaagcaatcagcaatccagtgatgaggaaggacactatcccttgcagcaaaaggagc 120
           |||||||||||  ||| ||| | ||||||||||||||||||||||||||  |||| ||  
Sbjct: 128 gctaaagcaataggcactccggcgatgaggaaggacactatcccttgcaagaaaaagaat 187

                                                                       
Query: 121 cctaaggatccctgc---ccattgcccatagctaacccatacaatagaggttgtcaccca 177
              ||| ||||||||   | |||||||||||||||||||||||||||||||||||| |||
Sbjct: 188 ggcaagaatccctgccaacaattgcccatagctaacccatacaatagaggttgtcagcca 247

                                         
Query: 178 gagcaacgttgtcgcagcactactactcct 207
           | ||||||||||||| || || ||||||||
Sbjct: 248 gggcaacgttgtcgcggctctcctactcct 277