Miyakogusa Predicted Gene

Lj0g3v0050299.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0050299.1 Non Chatacterized Hit- tr|I1KNY9|I1KNY9_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,81.85,0,SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; Serine/Threonine protein kinases,
catalytic,Serine/,NODE_6619_length_2272_cov_204.922531.path1.1
         (1791 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78921 homologue to UniRef100_A7PAI1 Cluster: Chromoso...    78   2e-13

>gnl|LJGI|TC78921 homologue to UniRef100_A7PAI1 Cluster: Chromosome chr14 scaffold_9,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr14 scaffold_9, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (36%)
          Length = 771

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1305 agtgaggggcaccatgggtcatattgcccctgaatatttgtcaactggaaaatcatctga 1364
            ||||||||||||  |||||||||||||||| || ||||| || |||||  |||| |||||
Sbjct: 190  agtgaggggcactgtgggtcatattgccccagagtatttatccactggtcaatcctctga 249

                                       
Query: 1365 gaagacagatgtatttggatatggcat 1391
            |||||| ||||| ||||||| ||||||
Sbjct: 250  gaagaccgatgtctttggatttggcat 276