Miyakogusa Predicted Gene

Lj0g3v0008169.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0008169.1 Non Chatacterized Hit- tr|I1MZE2|I1MZE2_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,62.71,0.00000002,
,916_g.1
         (175 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77862 homologue to UniRef100_A5HVE5 Cluster: DELLA pr...   283   2e-76

>gnl|LJGI|TC77862 homologue to UniRef100_A5HVE5 Cluster: DELLA protein; n=1;
           Phaseolus vulgaris|Rep: DELLA protein - Phaseolus
           vulgaris (Kidney bean) (French bean), partial (13%)
          Length = 756

 Score =  283 bits (143), Expect = 2e-76
 Identities = 167/175 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaagagagatcaccaagatagctgcaaaggaggcaacactgagagtgggaggaacagt 60
           ||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||
Sbjct: 205 atgaagagagatcaccaagatagctgcaaaggagggaacactgggagtgtgaggaacagt 264

                                                                       
Query: 61  gttggtactgtgaaaggtgaatgctcgtcaatgccgaacgacaaggccaagatgtgggag 120
           |||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 265 gttggtgctgtgaaaggtgaatgctcgtcaatgccgaccggcaaggccaagatgtgggag 324

                                                                  
Query: 121 gaggaacacggcggcgccgccggagtggatgagcttctggcggctttaggttaca 175
           || ||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 325 gaagaacacggcggcgccgccggagttgatgagcttctggcggctttaggttaca 379