HUGE

Gene/Protein Characteristic Table for KIAA1804

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06005
Accession No. :	AB058707
Description :	Mitogen-activated protein kinase kinase kinase.
HUGO Gene Name :
Clone Name :	fj22769 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4007 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2438 bp

Genome contig ID gi89161185f_231478152
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
TTAATAAACTTTTATAGCTGGTCTATTTGCTCAGT
Flanking genome sequence
(109366 - 109415)
----+----*----+----*----+----*----+----*----+----*
AGCTTTGATCCTCTCTTGATTATTGTGACTATAGTTTGCAATGGTTTATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 231578152 231587516 4 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI23047	6.7e-175	100.0	mitogen-activat...	Homo sapiens
Q5TCX8	7.4e-173	99.8	Mitogen-activat...	Homo sapiens
CAC84640	9.2e-170	98.3	mixed lineage k...	Homo sapiens
XP_001103092	2e-156	91.8	mixed lineage k...	Macaca mulatta
XP_001492336	3.8e-117	71.0	similar to mixe...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGCCGTCTTCCTTCCTACAG

Primer_r
: AGTGGCTGAGATAATAGTTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2438 bp
Genome contig ID	gi89161185f_231478152
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- TTAATAAACTTTTATAGCTGGTCTATTTGCTCAGT
Flanking genome sequence (109366 - 109415)	----+--------+--------+--------+--------+----* AGCTTTGATCCTCTCTTGATTATTGTGACTATAGTTTGCAATGGTTTATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	231578152	231587516	4	99.1	Perfect prediction

Primer_f	: TTGCCGTCTTCCTTCCTACAG
Primer_r	: AGTGGCTGAGATAATAGTTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1804

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information