| HUGE |
Gene/Protein Characteristic Table for KIAA1632 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | |
|---|---|
| Accession No. : | AB046852 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | fh19068 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5394 bp
|
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
| cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 80 bp Genome contig ID gi51511735r_41641828 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AACTGGTCATATTCATAATAAAACAATTTATTGATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGAAAATGGGTAGTCACTCAGATGGTCATTGTTTCTATGGTTTTGTCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 r 41741828 41801238 24 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1457 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TTTGGTAAGCTGGATTGTGGC | |
| : GCAGAGTTTATCACCAATTCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 18 |
| : CCR | |
| : TTTGGTAAGCTGGATTGTGGC | |
| : GCAGAGTTTATCACCAATTCC | |
| : 168(1.6k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |