HUGE

Gene/Protein Characteristic Table for KIAA1551

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04312
Accession No. :	AB046771
Description :	Uncharacterized protein C12orf35 (Fragment).
HUGO Gene Name :
Clone Name :	fh21239 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3829 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 78 bp

Genome contig ID gi89161190f_31925654
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
TATGAATAAAAACAGCATTGTTCAGAAATACCTTC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 32025654 32029351 1 99.0 Terminal No-hit

Features of the protein sequence	Description

Length: 1249 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW88538	99.7	chromosome 12 o...	Homo sapiens
Q9HCM1	99.7	Uncharacterized...	Homo sapiens
EAW88537	99.7	chromosome 12 o...	Homo sapiens
AAI40820	99.6	Chromosome 12 o...	Homo sapiens
XP_001084139	92.1	similar to Stre...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCCAGCAAACTACATACCAG

Primer_r
: ACTACATAGGGTTGATCATCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: CCR
Primer_f	: GGCCAGCAAACTACATACCAG
Primer_r	: ACTACATAGGGTTGATCATCC
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	78 bp
Genome contig ID	gi89161190f_31925654
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TATGAATAAAAACAGCATTGTTCAGAAATACCTTC
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	32025654	32029351	1	99.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1551

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information