HUGE

Gene/Protein Characteristic Table for KIAA1324

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05652
Accession No. :	AB037745
Description :	K1324_HUMAN Isoform 2 of Q6UXG2 - Homo sapiens.
HUGO Gene Name :
Clone Name :	fh14139 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5567 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3823 bp

Genome contig ID gi89161185f_109433263
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CTTTTTTTTTTTTGTAAAATAAAAACATACCTTAC
Flanking genome sequence
(117663 - 117712)
----+----*----+----*----+----*----+----*----+----*
AAGTTGTTTTTCTTAAACATGGGTTGGGTGGCTGGAGGGGTGAGTGGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 109533263 109550924 14 99.1 Internal No-hit

Features of the protein sequence	Description

Length: 580 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG59704	99.8	unnamed protein...	Homo sapiens
AAQ88732	100.0	AEPG2426 [Homo ...	Homo sapiens
BAG63086	99.6	unnamed protein...	Homo sapiens
NP_065826	99.6	hypothetical pr...	Homo sapiens
BAG59899	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTACCTTGAGTCCTGGAACAC

Primer_r
: CCTACTGCTTGAATACACCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTACCTTGAGTCCTGGAACAC
Primer_r	: CCTACTGCTTGAATACACCAC
PCR product length	: 101 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3823 bp
Genome contig ID	gi89161185f_109433263
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CTTTTTTTTTTTTGTAAAATAAAAACATACCTTAC
Flanking genome sequence (117663 - 117712)	----+--------+--------+--------+--------+----* AAGTTGTTTTTCTTAAACATGGGTTGGGTGGCTGGAGGGGTGAGTGGGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	109533263	109550924	14	99.1	Internal No-hit

Gene/Protein Characteristic Table for KIAA1324

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information