KIAA1774

Product ID	ORK04514
Accession No	AB053445
Description	cadherin-related 23
Clone name	hk10268
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4256 bp) Predicted protein sequence (1041 aa)
Source	Human adult brain

Length: 4256 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1078 bp
Genome contig ID	gi89161187f_73126672
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAACAGAAGTGACTGATGTTCCCTCCGGTTTTG
Flanking genome sequence (118989 - 119038)	----+--------+--------+--------+--------+----* AATGTGGAGTGTTTGTGTGTGTTCCTTTTTTAAATTAAGTTATTCCCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	73226619	73245659	21	99.7	Perfect prediction

Length: 1041 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H251	99.9	Cadherin-23; Ot...	Homo sapiens
NP_071407	99.9	cadherin-like 2...	Homo sapiens
CAI13426	99.9	cadherin-like 2...	Homo sapiens
EAW54426	99.8	cadherin-like 2...	Homo sapiens
AAT72166	99.8	cadherin 23 iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058715	8e-44	32.0	KIAA1812
AB002325	2e-38	30.7	KIAA0327
AB053446	1e-35	32.3	KIAA1773
AB046841	2.8e-35	28.1	KIAA1621
AB037821	8e-31	29.8	KIAA1400

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	274	293	PR00205	Cadherin
	IPR002126	337	366	PR00205	Cadherin
	IPR002126	404	416	PR00205	Cadherin
	IPR002126	418	437	PR00205	Cadherin
	IPR002126	497	523	PR00205	Cadherin
	IPR002126	532	549	PR00205	Cadherin
HMMPfam	IPR002126	129	221	PF00028	Cadherin
	IPR002126	235	328	PF00028	Cadherin
	IPR002126	342	430	PF00028	Cadherin
	IPR002126	446	534	PF00028	Cadherin
	IPR002126	561	643	PF00028	Cadherin
	IPR002126	679	714	PF00028	Cadherin
HMMSmart	IPR002126	24	119	SM00112	Cadherin
	IPR002126	146	228	SM00112	Cadherin
	IPR002126	252	335	SM00112	Cadherin
	IPR002126	359	437	SM00112	Cadherin
	IPR002126	463	548	SM00112	Cadherin
	IPR002126	579	672	SM00112	Cadherin
ProfileScan	IPR002126	65	121	PS50268	Cadherin
	IPR002126	125	230	PS50268	Cadherin
	IPR002126	231	337	PS50268	Cadherin
	IPR002126	338	439	PS50268	Cadherin
	IPR002126	442	550	PS50268	Cadherin
	IPR002126	557	674	PS50268	Cadherin
	IPR002126	675	803	PS50268	Cadherin
ScanRegExp	IPR002126	109	119	PS00232	Cadherin
	IPR002126	218	228	PS00232	Cadherin
	IPR002126	427	437	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	893	LQMAIIVLAILLFLAAMLFVLMN	915	PRIMARY	23

Primer_f	CCAAGTCTCGCTACATTTCCG
Primer_r	GTGAAATGGAGAGAATGCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCAAGTCTCGCTACATTTCCG
Primer_r	GTGAAATGGAGAGAATGCTTG
PCR product length	115 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles